text2genome

About us

Related Links

Press Coverage

PubMed: 20406462    PubMedCentral: PMC2864217

Regulation of MCP-1 chemokine transcription by p53.

Hacke K, Rincon-Orozco B, Buchwalter G, Siehler SY, Wasylyk B, Wiesmüller L, Rösl F
Molecular cancer, 82 , 2010

Abstract:

BACKGROUND: Our previous studies showed that the expression of the monocyte-chemoattractant protein (MCP)-1, a chemokine, which triggers the infiltration and activation of cells of the monocyte-macrophage lineage, is abrogated in human papillomavirus (HPV)-positive premalignant and malignant cells. In silico analysis of the MCP-1 upstream region proposed a putative p53 binding side about 2.5 kb upstream of the transcriptional start. The aim of this study is to monitor a physiological role of p53 in this process. RESULTS: The proposed p53 binding side could be confirmed in vitro by electrophoretic-mobility-shift assays and in vivo by chromatin immunoprecipitation. Moreover, the availability of p53 is apparently important for chemokine regulation, since TNF-alpha can induce MCP-1 only in human keratinocytes expressing the viral oncoprotein E7, but not in HPV16 E6 positive cells, where p53 becomes degraded. A general physiological role of p53 in MCP-1 regulation was further substantiated in HPV-negative cells harboring a temperature-sensitive mutant of p53 and in Li-Fraumeni cells, carrying a germ-line mutation of p53. In both cases, non-functional p53 leads to diminished MCP-1 transcription upon TNF-alpha treatment. In addition, siRNA directed against p53 decreased MCP-1 transcription after TNF-alpha addition, directly confirming a crosstalk between p53 and MCP-1. CONCLUSION: These data support the concept that p53 inactivation during carcinogenesis also affects immune surveillance by interfering with chemokine expression and in turn communication with cells of the immunological compartment.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:6347/CCL2
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
CCL2 ENSG00000108691 0,1
TP53 ENSG00000141510 4,5
GAPDH ENSG00000111640 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
6 chr12:63149085-63149109
7 chr15:44356229-44356251
7 chr6:166478298-166478320
6 chr2:38512633-38513080
4, 5 chr17:7579912-7590797
6 chrX:46300043-46300067
6 chr22:41070349-41070373
6 chr15:64821763-64821787
3 chr1:241798644-241798664
6 chr6:135941203-135941227
18, 19 chr6:36644194-36644438
6 chr12:6645712-6645736
7 chr11:88141831-88141853
3 chr9:21077403-21077423
7 chr6:57687422-57687444
0, 1, 12, 13, 14, 15, 16, 17 chr17:32579764-32583919
6 chrX:39647284-39647308
7 chr6:58294420-58294442

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2864217.pdf CAGATGCAATCAATGCCCCAGT
1 PMC2864217.pdf ATAAAACAGGGTGTCTGGGGAAAGC
2 PMC2864217.pdf GATTCATATAGCACTGGCTTG
3 PMC2864217.pdf CTTCAGGTAATGCAGAATCC
4 PMC2864217.pdf AGAGCCACCGTCCAGGGAGC
5 PMC2864217.pdf GGCAGTGACCCGGAAGGCAG
6 PMC2864217.pdf TGGATATTGTTGCCATCAATGACC
7 PMC2864217.pdf GATGGCATGGACTGTGGTCATG
8 PMC2864217.pdf TCGAGTTGCCTGGACTTGCCTGGCCTTGCCTTTTC
9 PMC2864217.pdf GAAAAGGCAAGGCCAGGCAAGTCCAGGCAACTCGA
10 PMC2864217.pdf TCGAGTTTAATGGACTTTAATGGCCTTTAATTTTC
11 PMC2864217.pdf GAAAATTAAAGGCCATTAAAGTCCATTAAACTCGA
12 PMC2864217.pdf AGAGATGACAACTCCTTCCTGAAGTAGAGACATGCTTCCAA
13 PMC2864217.pdf TTGGAAGCATGTCTCTACTTCAGGAAGGAGTTGTCATCTCT
14 PMC2864217.pdf GCAGAAGTGGGAGGCAGACA
15 PMC2864217.pdf GGCTTATAGACATCCTGTGGCATG
16 PMC2864217.pdf TTCTGATTCATACCCTTCACCTTCC
17 PMC2864217.pdf GATAAAGCCACAATCCAGAGAAGGA
18 PMC2864217.pdf CTGTGGCTCTGATTGGCTTT
19 PMC2864217.pdf ACACAAGCACACATGCATCA
20 PMC2864217.pdf tGACAAcTCCAGACATGCTT
Display recognized sequences in FASTA format