text2genome

About us

Related Links

Press Coverage

PubMed: 19953283    PubMedCentral: PMC2812423

Expression of TLR2, TLR4, and TLR9 in dermatomyositis and polymyositis.

Kim GT, Cho ML, Park YE, Yoo WH, Kim JH, Oh HJ, Kim DS, Baek SH, Lee SH, Lee JH, Kim HY, Kim SI
Clinical rheumatology, 273 , 2010

Abstract:

The aim of this study was to investigate the expressions of Toll-like receptor (TLR) 2, TLR4, TLR9, and their correlations with the expression of cytokines that are associated with activation of CD4(+) T cells and inflammation including interferon gamma (IFNgamma), interleukin 4 (IL4), interleukin 17 (IL17), and tumor necrosis factor alpha (TNFalpha) in muscle tissues of patients with dermatomyositis (DM) and polymyositis (PM). The expressions of TLR2, TLR4, TLR9, IFNgamma, IL4, IL17, and TNFalpha were measured by real-time reverse transcription-polymerase chain reaction in muscle tissues from 14 patients with DM and PM (nine patients with DM, five patients with PM) and three controls. The expressions of TLR2, TLR4, and TLR9 were also localized with immunohistochemistry. The expression levels of TLR2, TLR4, TLR9, IFNgamma, IL4, IL17, and TNFalpha were significantly high in patients with DM and PM compared with those in the controls, and the expression levels of TLR4 and TLR9 had significant positive correlations with the expressions of IFNgamma, IL4, IL17, and TNFalpha. Immunohistochemistry showed that TLR2, TLR4, and TLR9 were expressed by infiltrating cells of perimysium in DM, whereas they were expressed by infiltrating cells of endomysium in PM. These results suggest that the involvement of TLR4 and TLR9 in immunopathogenesis of DM and PM might be connected with activation of CD4(+) T cells.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:7097/TLR2
EntrezGene:7099/TLR4
EntrezGene:54106/TLR9
Species found in fulltext (Linnaeus)
Homo sapiens
Avian myeloblastosis virus
Mus musculus
Human coxsackievirus B3

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tlr4 ENSMUSG00000039005 1,2
Il17a ENSMUSG00000025929 9,10
Tnf ENSMUSG00000024401 11,12

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
9, 10 chr1:20723810-20724110
1, 2 chr4:66502111-66502184
11, 12 chr17:35337307-35337508
0 chr3:83640852-83640871

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2812423.pdf GCCACCATTTCCACGGACT
1 PMC2812423.pdf CTCTGCCTTCACTACAGAGACTTT
2 PMC2812423.pdf TGTGGAAGCCTTCCTGGATG
3 PMC2812423.pdf ACTGAGCACCCCTGCTTCTA
4 PMC2812423.pdf AGATTAGTCACGGCAGGAA
5 PMC2812423.pdf TCCCATGGGTTGTGTGTTTA
6 PMC2812423.pdf AAGCACCAGGCATGAAATCT
7 PMC2812423.pdf ACCCAAACTAGGCCTCACCT
8 PMC2812423.pdf ACAGGTGGCATCTTGGAAAC
9 PMC2812423.pdf TCTCATCCAGCAAGAGATCC
10 PMC2812423.pdf AGTTTGGGACCCCTTTACAC
11 PMC2812423.pdf CAAACCACCAAGTGGAGGAG
12 PMC2812423.pdf AGATAGCAAATCGGCTGACG
Display recognized sequences in FASTA format