text2genome

About us

Related Links

Press Coverage

PubMed: 19220876    PubMedCentral: PMC2657777

Indexing TNF-alpha gene expression using a gene-targeted reporter cell line.

Yan Z, Lei-Butters D, Engelhardt JF, Leno GH
BMC biology, 8 , 2009

Abstract:

BACKGROUND: Current cell-based drug screening technologies utilize randomly integrated reporter genes to index transcriptional activity of an endogenous gene of interest. In this context, reporter expression is controlled by known genetic elements that may only partially capture gene regulation and by unknown features of chromatin specific to the integration site. As an alternative technology, we applied highly efficient gene-targeting with recombinant adeno-associated virus to precisely integrate a luciferase reporter gene into exon 1 of the HeLa cell tumor necrosis factor-alpha (TNF-alpha) gene. Drugs known to induce TNF-alpha expression were then used to compare the authenticity of gene-targeted and randomly integrated transcriptional reporters. RESULTS: TNF-alpha-targeted reporter activity reflected endogenous TNF-alpha mRNA expression, whereas randomly integrated TNF-alpha reporter lines gave variable expression in response to transcriptional and epigenetic regulators. 5,6-Dimethylxanthenone-4-acetic acid (DMXAA), currently used in cancer clinical trials to induce TNF-alpha gene transcription, was only effective at inducing reporter expression from TNF-alpha gene-targeted cells. CONCLUSION: We conclude that gene-targeted reporter cell lines provide predictive indexing of gene transcription for drug discovery.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Adeno-associated virus
Mus musculus
Homo sapiens
Simian virus 40
Adeno-associated virus - 2
Sus scrofa
Mustela putorius furo
Genes found in fulltext (GNAT)
EntrezGene:2597/GAPDH
EntrezGene:5592/PRKG1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000204490 1,4
TNF ENSG00000206439 1,4
TNF ENSG00000223952 1,4
TNF ENSG00000228321 1,4
TNF ENSG00000228849 1,4
TNF ENSG00000230108 1,4
TNF ENSG00000232810 1,4

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1, 2, 4, 6, 8, 11, 13 HSCHR6_MHC_MANN:31581679-31584528
0, 1, 2, 4, 6, 8, 11, 13 HSCHR6_MHC_MCF:31618501-31621350
0, 1, 2, 4, 6, 8, 11, 13 chr6:31542192-31545041
0, 1, 2, 4, 6, 8, 11, 13 HSCHR6_MHC_SSTO:31532135-31534984
0, 1, 2, 4, 6, 8, 11, 13 HSCHR6_MHC_COX:31529604-31532453
0, 1, 2, 4, 6, 8, 11, 13 HSCHR6_MHC_DBB:31524336-31527185
0, 1, 2, 4, 6, 8, 11, 13 HSCHR6_MHC_QBL:31532433-31535284

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2657777.pdf GAGCTGTGGGGAGAACAAAAGGA
1 PMC2657777.pdf TTGGCCCTTGAAGAGGACCTG
2 PMC2657777.pdf cccaagcttAGAGCCTCCAGGACCTCCAGGTAT
3 PMC2657777.pdf aactttcgaagtCATGGTGTCCTTTCCAGGG
4 PMC2657777.pdf cgagctaGCACTGAAAGCATGATCCGGG
5 PMC2657777.pdf ccatcgatGGGTTCGAGAAGATGATCCTGAAG
6 PMC2657777.pdf GGAAGCAAAGGAGAAGCTGAGAAGA
7 PMC2657777.pdf AAGCGAAGGAGCAAAGCTGCTA
8 PMC2657777.pdf GCTCTGAGGAATGGGTTACAGGAG
9 PMC2657777.pdf CCCAATCATGGCCGACAAAA
10 PMC2657777.pdf ACGTGACCCTGTTCATCAGCG
11 PMC2657777.pdf CGAGTCCTTCTCACATTGTCTCCAA
12 PMC2657777.pdf TCGGAGGTCGTGTCCACGAACTT
13 PMC2657777.pdf CCTAGCCCTCCAAGTTCCAAGACAA
14 PMC2657777.pdf GTGAAGTTCGTCGTCCAACATT
15 PMC2657777.pdf AACGTCAGGTTTACCACCTTTTACT
Display recognized sequences in FASTA format