text2genome

About us

Related Links

Press Coverage

PubMed: 20017945    PubMedCentral: PMC2806269

Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome.

Taja-Chayeb L, Vidal-Millán S, Gutiérrez-Hernández O, Trejo-Becerril C, Pérez-Cárdenas E, Chávez-Blanco A, de la Cruz-Hernández E, Dueñas-González A
World journal of surgical oncology, 97 , 2009

Abstract:

BACKGROUND: Germ-line mutations of the TP53 gene are known to cause Li-Fraumeni syndrome, an autosomal, dominantly inherited, high-penetrance cancer-predisposition syndrome characterized by the occurrence of a variety of cancers, mainly soft tissue sarcomas, adrenocortical carcinoma, leukemia, breast cancer, and brain tumors. METHODS: Mutation analysis was based on Denaturing high performance liquid chromatography (DHPLC) screening of exons 2-11 of the TP53 gene, sequencing, and cloning of DNA obtained from peripheral blood lymphocytes. RESULTS: We report herein on Li Fraumeni syndrome in a family whose members are carriers of a novel TP53 gene mutation at exon 4. The mutation comprises an insertion/duplication of seven nucleotides affecting codon 110 and generating a new nucleotide sequence and a premature stop codon at position 150. With this mutation, the p53 protein that should be translated lacks the majority of the DNA binding domain. CONCLUSION: To our knowledge, this specific alteration has not been reported previously, but we believe it is the cause of the Li-Fraumeni syndrome in this family.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:7157/TP53
Genes found in fulltext (GNAT)
EntrezGene:31/ACACA
EntrezGene:3815/KIT
EntrezGene:4350/MPG
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 3,4

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1, 3, 4 chr17:7578486-7579416

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2806269.pdf GGTCCTCTGACTGCTCTTTTCACC
1 PMC2806269.pdf CAGGCATTGAAGTCTCATGGAAG
2 PMC2806269.pdf GTTTCCGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGt
3 PMC2806269.pdf TCTGGGCTTCTTGCATTCTGGGACAGCCAAGTC
4 PMC2806269.pdf TGGCCCCTGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGA
5 PMC2806269.pdf CGCCCGCGCCGCACCCGCGTCCGCGCC
Display recognized sequences in FASTA format