text2genome

About us

Related Links

Press Coverage

PubMed: 19956603    PubMedCentral: PMC2779453

Bone marrow stem cells expressing keratinocyte growth factor via an inducible lentivirus protects against bleomycin-induced pulmonary fibrosis.

Aguilar S, Scotton CJ, McNulty K, Nye E, Stamp G, Laurent G, Bonnet D, Janes SM
PloS one, , 2009

Abstract:

Many common diseases of the gas exchange surface of the lung have no specific treatment but cause serious morbidity and mortality. Idiopathic Pulmonary Fibrosis (IPF) is characterized by alveolar epithelial cell injury, interstitial inflammation, fibroblast proliferation and collagen accumulation within the lung parenchyma. Keratinocyte Growth Factor (KGF, also known as FGF-7) is a critical mediator of pulmonary epithelial repair through stimulation of epithelial cell proliferation. During repair, the lung not only uses resident cells after injury but also recruits circulating bone marrow-derived cells (BMDC). Several groups have used Mesenchymal Stromal Cells (MSCs) as therapeutic vectors, but little is known about the potential of Hematopoietic Stem cells (HSCs). Using an inducible lentiviral vector (Tet-On) expressing KGF, we were able to efficiently transduce both MSCs and HSCs, and demonstrated that KGF expression is induced in a regulated manner both in vitro and in vivo. We used the in vivo bleomycin-induced lung fibrosis model to assess the potential therapeutic effect of MSCs and HSCs. While both populations reduced the collagen accumulation associated with bleomycin-induced lung fibrosis, only transplantation of transduced HSCs greatly attenuated the histological damage. Using double immunohistochemistry, we show that the reduced lung damage likely occurs through endogenous type II pneumocyte proliferation induced by KGF. Taken together, our data indicates that bone marrow transplantation of lentivirus-transduced HSCs can attenuate lung damage, and shows for the first time the potential of using an inducible Tet-On system for cell based gene therapy in the lung.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:2252/FGF7
EntrezGene:14178/Fgf7
Genes found in fulltext (GNAT)
EntrezGene:14178/Fgf7
EntrezGene:16193/Il6
EntrezGene:17311/Kitl
EntrezGene:19264/Ptprc
EntrezGene:2252/FGF7
EntrezGene:2335/FN1
EntrezGene:3569/IL6
EntrezGene:51599/LSR
EntrezGene:5788/PTPRC
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Hprt1 ENSMUSG00000025630 4,5
Fgf7 ENSMUSG00000027208 8,9
Tnf ENSMUSG00000024401 10,11
Ccl2 ENSMUSG00000035385 12,13
Ccl9 ENSMUSG00000019122 14,15

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
14, 15 chr11:83389892-83391952
10 chr17:35338057-35338076
7 chr11:94811438-94811457
8 chr2:125861685-125861705
4, 5 chrX:50352317-50355328
9 chr2:125914000-125914020
12 chr11:81849141-81849162

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2779453.pdf cacgcgtgcccctctccctccc
1 PMC2779453.pdf acgcgatatctcgagtgcggccgcttta
2 PMC2779453.pdf acgcacgcgtatgcacaaatggatactgac
3 PMC2779453.pdf acgcgatatctcgagtgcggccgcttta
4 PMC2779453.pdf TCATTATGCCGAGGATTTGG
5 PMC2779453.pdf ACAGAGGGCCACAATGTGAT
6 PMC2779453.pdf TCATGGCTTCTCTGGTCTC
7 PMC2779453.pdf CCGTTGAGTCCGTCTTTGC
8 PMC2779453.pdf TTGACAAACGAGGCAAAGTG
9 PMC2779453.pdf CCCTTTGATTGCCACAATTC
10 PMC2779453.pdf CAAATGGCCTCCCTCTCAT
11 PMC2779453.pdf CACTTGGTGGTTTGCTACGA
12 PMC2779453.pdf AGCTCTCTCTTCCTCCACCAC
13 PMC2779453.pdf CGTTAACTGCATCTGGCTGA
14 PMC2779453.pdf TACTGCCCTCTCCTTCCTCA
15 PMC2779453.pdf AATTTCAAGCCCTTGCTGTG
Display recognized sequences in FASTA format