text2genome

About us

Related Links

Press Coverage

PubMed: 15689637    PubMedCentral: PMC1138266

Impact of Tumor-Derived CCL2 on Macrophage Effector Function.

Brault MS, Kurt RA
Journal of biomedicine & biotechnology, 37 , 2005

Abstract:

Monocyte chemoattractant protein-1 (MCP-1, CCL2) is produced by many different types of cells. In the current investigation, the effect of tumor-derived CCL2 on macrophages was evaluated to determine the extent to which this chemokine influenced the innate immune response to cancer. To do this, we used the 4T1 murine mammary carcinoma cell line that constitutively expresses CCL2 and generated 4T1 expressing an antisense CCL2 transcript. The antisense-CCL2-expressing 4T1 produced no detectable CCL2. Macrophages from female BALB/c mice were exposed to supernatants from these tumor cells. The results showed that tumor-derived CCL2 was capable of modulating cytokine gene expression but not protein production in resting, activated, and tumor-associated macrophages. In addition, tumor-derived CCL2 did not affect phagocytic activity, nitric oxide production, or cytolytic activity of the macrophages. Overall, these data suggest that tumor-derived CCL2 does not directly influence macrophage-mediated antitumor activity.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:16173/Il18
EntrezGene:20296/Ccl2
EntrezGene:2157/F8
EntrezGene:21926/Tnf
EntrezGene:3606/IL18
EntrezGene:3684/ITGAM
EntrezGene:3815/KIT
EntrezGene:6347/CCL2
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:7178/TPT1
EntrezGene:920/CD4
EntrezGene:9337/CNOT8

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Gapdh ENSMUSG00000057666 0,1
Il12b ENSMUSG00000004296 2,3
Tnf ENSMUSG00000024401 4,5
Il18 ENSMUSG00000039217 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 NT_166349:397252-397464
0, 1 chr15:93027858-93028070
6, 7 chr9:50387450-50389738
2, 3 chr11:44223789-44226841
0, 1 chr6:125112008-125112330
0, 1 chr1:102178864-102179076
0, 1 chr11:26687463-26687675
0, 1 chr8:60029929-60030141
0, 1 chr3:78722010-78722222
0, 1 chr3:139313173-139313385
0, 1 chr6:91379707-91379919
0, 1 chr6:83824331-83824543
0, 1 chr7:49380528-49380740
0, 1 chr11:20234973-20235185
0, 1 chr7:96757035-96757247
0, 1 chr17:61920296-61920508
0, 1 chr2:11330615-11330827
0, 1 chr5:13042391-13042603
0, 1 chr4:57383783-57383995
0, 1 chr2:28789086-28789298
0, 1 chr3:61265739-61265951
0, 1 chr3:121933071-121933283
0, 1 chr5:106291678-106291890
0, 1 chr17:14846891-14847103
0, 1 chr15:12505474-12505686
0, 1 chr14:12113404-12113616
0, 1 chr14:49029131-49029334
0, 1 chr8:77929375-77929587
0, 1 chr8:95239784-95239996
0, 1 chr3:52417587-52417799
0, 1 chr4:91518317-91518529
0, 1 chr6:128152123-128152335
0, 1 chr7:107909277-107909489
0, 1 chr2:43373942-43374087
0, 1 chr5:96291563-96291775
0, 1 chr3:142626405-142626617
4, 5 chr17:35338632-35338915
0, 1 chr7:59002897-59003109
0, 1 chrX:77439148-77439360
0, 1 chr5:28865940-28866152
0, 1 chr14:103769640-103769852
0, 1 chr11:63125770-63125982
0, 1 chr15:4835950-4836162

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1138266.pdf CAGGTTGTCTCCTGCGACTT
1 PMC1138266.pdf CTTGCTCAGTGTCCTTGCTG
2 PMC1138266.pdf GGAAGCACGGCAGCAGAATAA
3 PMC1138266.pdf AGCCAACCAAGCAGAAGACAG
4 PMC1138266.pdf CCAGGAGGGAGAACAGAAACT
5 PMC1138266.pdf CAGTAGACAGAAGAGCGTGGTG
6 PMC1138266.pdf CTGGCTGTGACCCTCTCTGT
7 PMC1138266.pdf AGCATCATCTTCCTTTTGGC
Display recognized sequences in FASTA format