text2genome

About us

Related Links

Press Coverage

PubMed: 17636051    PubMedCentral: PMC1976468

Molecular restoration of archived transcriptional profiles by complementary-template reverse-transcription (CT-RT).

Loudig O, Milova E, Brandwein-Gensler M, Massimi A, Belbin TJ, Childs G, Singer RH, Rohan T, Prystowsky MB
Nucleic acids research, e94 , 2007

Abstract:

Gene expression profiling of formalin-fixed and paraffin-embedded (FFPE) specimens, banked from completed clinical trials and routine clinical care, has the potential to yield valuable information implicating and linking genes with clinical parameters. In order to prepare high-quality cDNA from highly fragmented FFPE-RNA, previously precluded from high-throughput analyses, we have designed a novel strategy based on the nucleic acid restoration of incomplete cDNA sequences prior to T7 in vitro transcription (IVT) amplification. We describe this strategy as complementary-template reverse-transcription (CT-RT) because short single-stranded T7-oligo-dT24-VN-DNA sequences, obtained from FFPE-RNA, are used as primers for the RT of complementary RNA templates contained in a sense-RNA library. We validated our assay by determining the correlation between expression profiles of a matched 10-year-old frozen and FFPE breast cancer sample. We show that T7 IVT-amplification of cDNA transcripts restored by CT-RT is a specific and reliable process that allows recovery of transcriptional features undetectable by direct T7 IVT-amplification of FFPE-RNA. Furthermore, CT-RT restored 35-41% of the transcripts from archived breast and cervical specimens when compared to matched frozen tissue; and profiles included tissue-specific transcripts. Our results indicate that CT-RT allows microarray profiling of severely degraded RNA that could not be analyzed by previous methods.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Citrus maxima
Homo sapiens
Pollachius pollachius
Genes found in fulltext (GNAT)
EntrezGene:2064/ERBB2
EntrezGene:595/CCND1
EntrezGene:7157/TP53
EntrezGene:83881/MIXL1

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
CCND1 ENSG00000110092 2,3,4
TP53 ENSG00000141510 6,7,8
ERBB2 ENSG00000141736 9,10,11

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3, 4, 5 chr11:69468993-69469242
9, 10, 11 chr17:37884668-37884893
7, 8 chr17:7571740-7571817

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1976468.pdf GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGTACGACGT
1 PMC1976468.pdf CCGCCTCCCTATAGTGAGTCGTATTACAATTCACTGGCC
2 PMC1976468.pdf GATGGGGCAAGGGCACAAGTC
3 PMC1976468.pdf GCTGGGTCTGTGCATTTCTGG
4 PMC1976468.pdf CCCAGCACCAACATGTAACCGGC
5 PMC1976468.pdf TGGGGTTTTACCAGTTTTATTTC
6 PMC1976468.pdf GCTGGTCTCAAACTCCTGGGCTC
7 PMC1976468.pdf CCCACCCTTCCCCTCCTTCTCCC
8 PMC1976468.pdf GCAGCAAAGTTTTATTGTAAAATAAG
9 PMC1976468.pdf GCGACCCATTCAGAGACTGTCCC
10 PMC1976468.pdf GTGTCAGTATCCAGGCTTTGTAC
11 PMC1976468.pdf TGCAAATGGACAAAGTGGGTGTGGAG
Display recognized sequences in FASTA format