text2genome

About us

Related Links

Press Coverage

PubMed: 19238203    PubMedCentral: PMC2641016

RNAi methodologies for the functional study of signaling molecules.

Lee G, Santat LA, Chang MS, Choi S
PloS one, , 2009

Abstract:

RNA interference (RNAi) was investigated with the aim of achieving gene silencing with diverse RNAi platforms that include small interfering RNA (siRNA), short hairpin RNA (shRNA) and antisense oligonucleotides (ASO). Different versions of each system were used to silence the expression of specific subunits of the heterotrimeric signal transducing G-proteins, G alpha i2 and G beta 2, in the RAW 264.7 murine macrophage cell line. The specificity of the different RNA interference (RNAi) platforms was assessed by DNA microarray analysis. Reliable RNAi methodologies against the genes of interest were then developed and applied to functional studies of signaling networks. This study demonstrates a successful knockdown of target genes and shows the potential of RNAi for use in functional studies of signaling molecules.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:10249/GLYAT
EntrezGene:12826/Col4a1
EntrezGene:1959/EGR2
EntrezGene:2201/FBN2
EntrezGene:23405/DICER1
EntrezGene:26575/RSG17
EntrezGene:31/ACACA
EntrezGene:3458/IFNG
EntrezGene:3557/IL1RN
EntrezGene:3565/IL4
EntrezGene:3598/IL13RA2
EntrezGene:3654/IRAK1
EntrezGene:4350/MPG
EntrezGene:4615/MYD88
EntrezGene:5265/SERPINA1
EntrezGene:54106/TLR9
EntrezGene:6004/RGS16
EntrezGene:6347/CCL2
EntrezGene:64332/NFKBIZ
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7189/TRAF6
EntrezGene:7462/LAT2
EntrezGene:788/SLC25A20
EntrezGene:8720/MBTPS1
EntrezGene:929/CD14
EntrezGene:9531/BAG3

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Gnai2 ENSMUSG00000032562 0,1,2,4,5
Gnb2 ENSMUSG00000029713 9,3,6,7
Egr2 ENSMUSG00000037868 11,12
Tnf ENSMUSG00000024401 13,14
Actb ENSMUSG00000029580 15,16

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
11 chr10:67002633-67002654
15, 16 chr5:143667261-143668370
10 chr16:55818627-55818646
0, 1, 2, 4 chr9:107518100-107537517
3, 6, 7, 9 chr5:137970693-137971121

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2641016.pdf TTTAGAGCGCTCGGCTGCCG
1 PMC2641016.pdf GTCTACAGCAACACCATCC
2 PMC2641016.pdf GCACAGAGTGACTACATCC
3 PMC2641016.pdf CATCTGCTCCATCTATAGTC
4 PMC2641016.pdf GAGCAAGTTTGAGGATCTA
5 PMC2641016.pdf CCGCTTACTACCTGAATGA
6 PMC2641016.pdf GGACGGAAAGCTCATCATT
7 PMC2641016.pdf GGACGACAACCAAATCATC
8 PMC2641016.pdf TTTAGAGCGCTCGGCTGCCG
9 PMC2641016.pdf ATGAGCTTTCCGTCCTGGGA
10 PMC2641016.pdf GTAGGCGTTTGCGGTGATG
11 PMC2641016.pdf GTGCCAGCTGCTATCCAGAAG
12 PMC2641016.pdf GGCTGTGGTTGAAGCTGGAG
13 PMC2641016.pdf CCCTCACACTCAGATCATCTTCT
14 PMC2641016.pdf GCTACGACGTGGGCTACAG
15 PMC2641016.pdf CTTTGCAGCTCCTTCGTTGC
16 PMC2641016.pdf ACGATGGAGGGGAATACAGC
Display recognized sequences in FASTA format