text2genome

About us

Related Links

Press Coverage

PubMed: 18586819    PubMedCentral: PMC2504310

Light activation of transcription: photocaging of nucleotides for control over RNA polymerization.

Pinheiro AV, Baptista P, Lima JC
Nucleic acids research, e90 , 2008

Abstract:

We describe the use of ATP caged with [7-(diethylamino)coumarin-4-yl]methyl (DEACM) for light-controlled in vitro transcription reactions. Polymerization is blocked when DEACM is bonded to the gamma phosphate group of the ATP molecule. Controlled light irradiation releases ATP and transcription is initiated. In order to provide full control over the process, conditions involved in substrate release, nucleotide availability after release and the effect of the released coumarin in RNA polymerization were assessed in further detail. Together, our data provide the first direct evidence of control over enzymatic polymerization of nucleic acids through light. This approach may provide researchers with a unique tool for the study of biological processes at a molecular level.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:168400/DDX53
EntrezGene:3815/KIT
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,1

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr17:7577498-7577608

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2504310.pdf gttggctctgactgtaccac
1 PMC2504310.pdf ctggagtcttccagtgtgatg
2 PMC2504310.pdf taatacgactcactatagggagagttggctctgactgtaccac
3 PMC2504310.pdf taatacgactcactatagggaga
Display recognized sequences in FASTA format