text2genome

About us

Related Links

Press Coverage

PubMed: 17540029    PubMedCentral: PMC1894799

NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation.

Brynczka C, Labhart P, Merrick BA
BMC genomics, 139 , 2007

Abstract:

BACKGROUND: p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. RESULTS: Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. CONCLUSION: Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:24842/P53_RAT
Genes found in fulltext (GNAT)
EntrezGene:1026/CDKN1A
EntrezGene:10769/PLK2
EntrezGene:1499/CTNNB1
EntrezGene:1847/DUSP
EntrezGene:22059/Trp53
EntrezGene:22943/DKK1
EntrezGene:230824/Grhl3
EntrezGene:24842/P53_RAT
EntrezGene:362391/NP_001094219.1
EntrezGene:4193/MDM2
EntrezGene:4194/MDM4
EntrezGene:4803/NGF
EntrezGene:57761/TRIB3
EntrezGene:57822/GRHL3
EntrezGene:581/BAX
EntrezGene:7157/TP53
EntrezGene:7161/TP73
EntrezGene:7477/WNT7B
EntrezGene:8444/DYRK3
EntrezGene:8626/TP63

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
P53_RAT ENSRNOG00000010756 0,1,2

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1, 2 chr10:56406568-56408291
7 chr10:25744486-25776985

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1894799.pdf GCATACGGATTTCCTTCCACC
1 PMC1894799.pdf ATATCCGACTGTGAATCCTCC
2 PMC1894799.pdf AAAATTAGGTGACCCTGTCGC
3 PMC1894799.S1.pdf GCGGTGACCCGGGAGATCTGAATTCGAATTCAGATCCGCAGTCCTGAACCAAGATCTTGGCATAGTGTGGCAGATCTCGCAGTCCTGAACCAATGGCATAGTGTGGCAGGGCCACGCGTCGACTAGTACGATCGTACTAGTCGACGCGTGGCC
4 PMC1894799.S1.pdf CTGGGCTGCAAGGAAGACTCGGCTGTGTTATCAAGGCTCACCCTTGTATTCAGCAGGTGTACTTCTCCCACTCACCATTCCACTACGGTTCCATCCAGCATTTATTGTGTGGTAAGAGGCAAGGAGTGTCTCCCCTCTGACCACTTTGCCATGTGGCCAATATAGCAAGCAAACAAAGAGCCCAGTCAGAGGTCAGAGGCAGGTGAATCCCTCGACCAAGAGTCCATAGAGCCAGGGCTTGTGTTCCTAGTCGCATTCTTGGAAGGAAGAGAAAGCGTAACAATAACAAAGGCACAAGGCCATCTACTGCTAGGCACAGGTGACCATCCCTAAACCAGAAGAAGCCTGCCTCTATGGACACGCTGCATGTTACCCACATAACTCGCCAACTGTGTTTCTCAGATGGCTCCTGCAAAGAACTCAGGGGAGCAGGATCAGGTATTGCGCATGTCAGCTAAAGTCATAATCTCCTCCCATTCGTGTGAGAGGGACAGTGGGTTTGTGAGAGCAAGCAGTCAGGTGTGGATCAGGGTGGGAGTTGAGACCTCCCAGCTCCAAGATTACCATTCAACCCTTTCCGGTAGGACCCTGCAAGCAAGTCATCCTAGGGAGGAGGAGGAAAGTGGAATCACACCTAATTTCCCAGTGGTGCTGTAGGGTTGGACTTGTTACACGGCACACCTGACTGGGGAAAGCTGACTGGAGAAGTCAACTAACCTGTAAGCCGATTTATTACTCGTGCTCTGTTATCTCAATTCTTTGAAGCATGAAGCAGATAGGCTGTCCTCCTCCTCACTTCTTGGCTTGATGGACGTTAGCTGGGTTCCTGCTACGAGAGGCTGACATCTGACCTGGACTCCGTCACCCCTGACTATTTGACTGACCATGTTAGAGGACTTGCTATTCACTGCCACCACCCAGTAGTTTGTCCCGAGTTCCTTCTTCTTGAGACCCCTCGTCAGAAC
5 PMC1894799.S1.pdf GGGACTGGCACTATCCATTACTAGCATCGCTTGGTCTTCTGGCAGTAGGCCAGGGAAGTATGTCTTGCACATTTCACAACAGTGGCAGAACATGGGGTCTGAAGAGCAGCAGCAGGTGACATCAGGAGGAGAGGGCTGTTATGCCCACAAACCCTACTTTCATCGAGAAGTGTAAACAAGTAGGAAAATGAGCACAACCCACAGAACCTGACTCGGCAAGTGCTGTATGTTGCATTGGTGTGGTGATGTAGGGCTTTGCCATGAGAGGGTAGTCGCAGTCTATTGTTGCACAGTGGCTGTGTTCTTCACCATATCGCTGTCATTCCCAAGCTCATACGCCACTACCCTGACAAACCTGTGGGATGCAAGGATTTCAGATGCTGAGACACCCTGAACTGCCTCTTGGAAGGATGAACACACTGCGTCCTTCACACTGATCTGCCTTTGTCCCTCAAGTGTCTGGGCTTGTCTTCTCTCTTCTGTAAGGAGGACCGTGTGCCCTTGCCTAATACCCTTGAGCCTCTGCATTTGGAGGACAGGTGCAGCTTGACAGGAACTGTAGAGGTGTTGCGGGAGATGAGTCAGGCAGCGACATGAGAGGGAGGTGTGGCAGATAACTGTTTTGAAGATTGGGTCTCACAGGTAGGGGTGGAAGGATTACCAATGGCTCCTGGTCCTATGGTCCTTGCCCAGATCAGAACGTGGAGAGTCAGGCATGTTGCCACCGTCTCGATTTGTAGTCCGAGTCCTCATCACCAGTGTTGCAAGTTAGAGGGAATAGGAGAGTCTTATTTGGTGTCATAGCAGTGAGCTGCCCTAAAGGAACCAGAGTGAATGTCCCAGAGCATGTGTGTACCCAGCATCTGCAATCTTTAGGGGCCGGTGATAATGAGCCCTTTCTCAGGCTTGTCTGTGAAACCCTAGAATTGGACTGCAAGTAAAGCTGTTTGGGTATATGTGTGGACTTGATGGCAGATGAGCCTTAACGGTGGGAACAC
6 PMC1894799.S1.pdf AGGAACCTGTAGTTGCTCAGTCCCTCCCTAGAACCAGCATTTCTTGGCATTCTGTGAGCTGTGTTCTCTCCATGTCCTCCAAACTTTCCAGCTCTGCCATACTTCACCCACCCTCAAAGGTCAAGTCAGGAGACAGAGAGGGACAGTACAGGTGAGCCAGCATCTCTGAACATGCCTTCCAAGTAATCCCTTCCTGTGTCCACCTCAGAGTCAATTTAGGATTGCTCTTTATGACTTGGCCTGACCCACAGAGAAACCAAGCGCCACATAAACCAAAACCCACGCTCCTAATACTGTCGCTCTCCACTTTGTTGTGTCTAGTTGTGAAGGCCAGTTCTGGGCAGATTGGTGGAGTAGGGCACAGAGACTGAAGCAGAGCATGTCCGTGAGCTTGTAGCCATGTGCGATTAGGGTGTTGGGGGAGGGCAGAGAGACTACCCGGTAAACTGAGGCACAAGGGTGAGGGATGGAGAGAAAGGGCATAACTCTTGGCCTACCTAGAAGCTGGGCTCTGATTGCGCTCACACACATAAAAGAATCTCTGGGAAGAAGGAATCTCAGGCAGGAACCATAGGGAACTCCTTGGGCTGGGCTTTCTAACAATGGCAATAGGACCGTGACGCCCAACTAGCCATGAACTCCACACAATCACAGGCACTTGCCATTGCCACGTCCTTAAACGGAGAGAGTGGTGGGCATAACCAGTTGGAATGCAGAGACAGCTGTCCAGGGAGTGAGAAGCCAGCAAGCCTCTCAAAGTGAGGTCAAGCTGATGGAACAAGCCCAGCCTAGCTTTCATTTCTCTCTCTTTGGATGGCAAGTC
7 PMC1894799.S1.pdf CCCACCCAACATACACAAGTCCCTACCCCTTCTTCTCAGATTGCTGCCTCAATCTAGTCCCTGGAGTGTTTTATCAAGCTTCCCCTAAGGCTACAAAGCGCACCGACATTCTGAAGTGACCCTAGACCAAAAACCACCAGACCCCAGAATCAGTAGACCTAATGTCGGAAACCAGAGACATTAGCCCTTGAAGCAAAGCCCAGGAGCAAGAACTCAGGCTTTCGTTTATGCGATCCCATCACCATCTTCCAGCCTGCTTCACCACCTTCTTGAGAGCGTGGTGATGATTGTGTGTGCTGGACTGTGTTGAAGGGAACTGTCTGCTCATCTTCACTCTGCTCCTTTTTCTGCCCCTGACAATCCTTACCACACTCTCGTGCTAATTCTTGCGGAAGGTAGCAGGGAAAAGCGGCCAGGAAATGTCACTTGAGGAGGAACTCACACAGATGGGGAGGGAGAAAAGGTTAGTGCTCTACTCGTGGATTCAGGAAGTTCGGGGTGGTTTACGAACAAGCAGGAGGAAAAGGTGGAAGGGTCTGAAGATGGGAAGCAGCCCAGATGTCAGCGTCCCGTTTGGTGTAGAGGTGACCATTCTGCTGATTGCCGCTTTCTCCTGCCTGATAGGATTGGTATTCGGATTGCTCCATCGATTCCTTCATTGTCC
8 PMC1894799.S1.pdf GATGAGTGCTGTTTGTAGTGCAAGAAGGGGTAATAGGAGGAGGGTCTGGTGGATGTTCACTGAGCCAGGGATGTGTCAGGGCAGTGAGGCTCTATGCCAGGGTTTCCAGTATTGCCATACGAGGAGACTTTTGCGAGGCTTCTTCCAGTTCAGTTACGTTAGAGCGATTCCAGTCCACCTTTTGTGTAGTTCCTCCTTGCCACTTCTTACCTGCCGGGCATCTTTGTTCTAG
9 PMC1894799.S1.pdf CAGCCAAGTCTGTTATGTGCGTCTTCCAGCGTGATGATGTTGGTAAGGGAGAAAGACTGGCTGAGGGGAAATAGAGTCGAGGATGGACAGATGGTAGCTGATTTGCGGATGAGTAGTAGCAAGGCAACCAGAAACCACAAGGGGCACAAGTTCAAGTCTGTGCTTTGGTTTGCTGTTCTTGGTTCCCTCACTTTGCGAGCAGACAGGAAGCATCGCAATGACCACCAAGAACCCCATAACTCGGCATCTGACACTGAAGCGTCAACAAACCAGGGCTAGGGGTGTCATCTCAGGCAGGTGGAAGAGAAAGCACTGTGCCTCTGCTTGGATGGGGGAGGTTTTGGAACTGACTGGTGCTAGGCTTCTGTTCCATCCTTTTGGCTTGAGTCTGTGAAGAGGGCATAGTGTCATAGGCAGGTTGGGAAAAGCAAAGCACCCAAGTTAGAGTATCCAGTCCTCCAACAAGGTCGGGCTCATGTACTACCGTCCTCCTCGCAGTAGTTGAGGAAGATGGGAAGGAAAGATACGGGGAGAAAGAATAGC
Display recognized sequences in FASTA format