text2genome

About us

Related Links

Press Coverage

PubMed: 18559453    PubMedCentral: PMC2442644

Tumor angiogenesis and progression are enhanced by Sema4D produced by tumor-associated macrophages.

Sierra JR, Corso S, Caione L, Cepero V, Conrotto P, Cignetti A, Piacibello W, Kumanogoh A, Kikutani H, Comoglio PM, Tamagnone L, Giordano S
The Journal of experimental medicine, 1673 , 2008

Abstract:

Increased evidence suggests that cancer-associated inflammation supports tumor growth and progression. We have previously shown that semaphorin 4D (Sema4D), a ligand produced by different cell types, is a proangiogenic molecule that acts by binding to its receptor, plexin B1, expressed on endothelial cells (Conrotto, P., D. Valdembri, S. Corso, G. Serini, L. Tamagnone, P.M. Comoglio, F. Bussolino, and S. Giordano. 2005. Blood. 105:4321-4329). The present work highlights the role of Sema4D produced by the tumor microenvironment on neoplastic angiogenesis. We show that in an environment lacking Sema4D, the ability of cancer cells to generate tumor masses and metastases is severely impaired. This condition can be explained by a defective vascularization inside the tumor. We demonstrate that tumor-associated macrophages (TAMs) are the main cells producing Sema4D within the tumor stroma and that their ability to produce Sema4D is critical for tumor angiogenesis and vessel maturation. This study helps to explain the protumoral role of inflammatory cells of the tumor stroma and leads to the identification of an angiogenic molecule that might be a novel therapeutic target.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:20354/Sema4d
Genes found in fulltext (GNAT)
EntrezGene:10507/SEMA4D
EntrezGene:14123/Fbrs
EntrezGene:1435/CSF1
EntrezGene:17295/Met
EntrezGene:1760/DMPK
EntrezGene:19264/Ptprc
EntrezGene:20354/Sema4d
EntrezGene:21926/Tnf
EntrezGene:23654/PLXNB2
EntrezGene:3569/IL6
EntrezGene:3586/IL10
EntrezGene:6403/SELP
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7531/YWHAE
EntrezGene:971/CD72

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 4,5
Actb ENSMUSG00000029580 6,7
Plxnb1 ENSMUSG00000053646 8,9
Plxnb2 ENSMUSG00000036606 10,11
Ccl17 ENSMUSG00000031780 13,14
Msr1 ENSMUSG00000025044 15,16
Hgf ENSMUSG00000028864 17,18
Cd72 ENSMUSG00000028459 19,20
Il10 ENSMUSG00000016529 21,22
Csf1 ENSMUSG00000014599 23,24

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
23, 24 chr3:107551671-107551855
19 chr4:43462982-43463002
19 chrX:44820456-44820476
27 chr13:51810167-51810188
17, 18 chr5:16066913-16070701
34 chr12:102444116-102444136
6, 7 chr5:143666435-143667054
12 chr6:17484164-17484185
1 chrY:76240-76260
8, 9 chr9:109008514-109009042
13, 14 chr8:97335176-97335825
4, 5 chr17:35338791-35338918
2, 3 chr11:120209687-120209789
21, 22 chr1:132917919-132919088
15, 16 chr8:40693454-40701134
10, 11 chr15:88989178-88989527

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2442644.pdf CAATCCCAAACCTGCTTGT
1 PMC2442644.pdf CTCCCCTTCAGCTCTTCCTT
2 PMC2442644.pdf GCTTACACTGCGCTTCTTGC
3 PMC2442644.pdf AGAAAGGGCCACAGGAAGTC
4 PMC2442644.pdf TAGCCAGGAGGGAGAACAGA
5 PMC2442644.pdf TTTTCTGGAGGGAGATGTGG
6 PMC2442644.pdf TGTTACCAACTGGGACGACA
7 PMC2442644.pdf GGGGTGTTGAAGGTCTCAAA
8 PMC2442644.pdf CAGATGTCTGGTGCCACATC
9 PMC2442644.pdf CCCTCACACCACACACAGTC
10 PMC2442644.pdf AGGGGAGCCTCTCTACAAGC
11 PMC2442644.pdf TCGATCCCTTCATCCTGAAC
12 PMC2442644.pdf GAGTGAGTAAGGTGCCTCCAG
13 PMC2442644.pdf AGTGGAGTGTTCCAGGGATG
14 PMC2442644.pdf CTGGTCACAGGCCGTTTTAT
15 PMC2442644.pdf CTGGACAAACTGGTCCACCT
16 PMC2442644.pdf CCCCTTCTCTCCCTTTTGTC
17 PMC2442644.pdf AGGAACAGGGGCTTTACGTT
18 PMC2442644.pdf GTCAAATTCATGGCCAAACC
19 PMC2442644.pdf CTGCACATCTCTGTCCTCCA
20 PMC2442644.pdf TCAGAGTCCTGCCTCCACTT
21 PMC2442644.pdf CCAAGCCTTATCGGAAATGA
22 PMC2442644.pdf TTTTCACAGGGGAGAAATCG
23 PMC2442644.pdf GACCCTCGAGTCAACAGAGC
24 PMC2442644.pdf TGCTTCCTGGGTCAAAAATC
25 PMC2442644.pdf TGTTACCAACTGGGACGACA
26 PMC2442644.pdf GGGGTGTTGAAGGTCTCAAA
27 PMC2442644.pdf CCACAGCTACACATCAGTCAT
28 PMC2442644.pdf CCAGCTCTTCCAGGACTTTG
29 PMC2442644.pdf ACTTTTATCCGGGCACACAG
30 PMC2442644.pdf GGGCAATGATCCCAAAGTAG
31 PMC2442644.pdf GTTGCCAAGCCTTGTCTGA
32 PMC2442644.pdf GGCCTTGCTCTTGTTTTCAC
33 PMC2442644.pdf ACAGTCAGCCGCATCTTCTT
34 PMC2442644.pdf GACAAGCTTCCCGTTCTCAG
Display recognized sequences in FASTA format