text2genome

About us

Related Links

Press Coverage

PubMed: 20482876    PubMedCentral: PMC2881061

p38 mediates mechanical allodynia in a mouse model of type 2 diabetes.

Cheng HT, Dauch JR, Oh SS, Hayes JM, Hong Y, Feldman EL
Molecular pain, 28 , 2010

Abstract:

BACKGROUND: Painful Diabetic Neuropathy (PDN) affects more than 25% of patients with type 2 diabetes; however, the pathogenesis remains unclear due to lack of knowledge of the molecular mechanisms leading to PDN. In our current study, we use an animal model of type 2 diabetes in order to understand the roles of p38 in PDN. Previously, we have demonstrated that the C57BLK db/db (db/db) mouse, a model of type 2 diabetes that carries the loss-of-function leptin receptor mutant, develops mechanical allodynia in the hind paws during the early stage (6-12 wk of age) of diabetes. Using this timeline of PDN, we can investigate the signaling mechanisms underlying mechanical allodynia in the db/db mouse. RESULTS: We studied the role of p38 in lumbar dorsal root ganglia (LDRG) during the development of mechanical allodynia in db/db mice. p38 phosphorylation was detected by immunoblots at the early stage of mechanical allodynia in LDRG of diabetic mice. Phosphorylated p38 (pp38) immunoreactivity was detected mostly in the small- to medium-sized LDRG neurons during the time period of mechanical allodynia. Treatment with an antibody against nerve growth factor (NGF) significantly inhibited p38 phosphorylation in LDRG of diabetic mice. In addition, we detected higher levels of inflammatory mediators, including cyclooxygenase (COX) 2, inducible nitric oxide synthases (iNOS), and tumor necrosis factor (TNF)-alpha in LDRG neurons of db/db mice compared to non-diabetic db+ mice. Intrathecal delivery of SB203580, a p38 inhibitor, significantly inhibited the development of mechanical allodynia and the upregulation of COX2, iNOS and TNF-alpha. CONCLUSIONS: Our findings suggest that NGF activated-p38 phosphorylation mediates mechanical allodynia in the db/db mouse by upregulation of multiple inflammatory mediators in LDRG.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Ptgs2 ENSMUSG00000032487 0,1
Nos2 ENSMUSG00000020826 2,3
Tnf ENSMUSG00000024401 4,5
BX005163.13-1 ENSMUSG00000074353 6,7
CT030181.13 ENSMUSG00000078308 6,7
RP23-41A24.1 ENSMUSG00000081892 6,7
RP24-422L8.2 ENSMUSG00000082085 6,7
RP23-408E16.1 ENSMUSG00000082927 6,7
RP23-31I2.4 ENSMUSG00000083391 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
4, 5 chr17:35337086-35337323
0, 1 chr1:151951205-151951461
6, 7 chrX:117274808-117275185
6, 7 chrX:85817530-85817908
6, 7 chr1:23486849-23487226
6, 7 chrX:141699514-141699891

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2881061.pdf GATGAGCAACTATTCCAAACCAG
1 PMC2881061.pdf CCGCTCAGGTGTTGCACGTAG
2 PMC2881061.pdf GGGCAGCCTGTGAGACCTT
3 PMC2881061.pdf TGAGGGCTCTGTTGAGGTCTA
4 PMC2881061.pdf AGCCGATTTGCTATCTCATACCAG
5 PMC2881061.pdf CCTTCACAGAGCAATGACTCCA
6 PMC2881061.pdf TCCATGACAACTTTGGCATCGTGG
7 PMC2881061.pdf GTTGCTGTTGAAGTCACAGGAGAC
Display recognized sequences in FASTA format