text2genome

About us

Related Links

Press Coverage

PubMed: 19638969    PubMedCentral: PMC2724974

Coordinated posttranscriptional mRNA population dynamics during T-cell activation.

Mukherjee N, Lager PJ, Friedersdorf MB, Thompson MA, Keene JD
Molecular systems biology, 288 , 2009

Abstract:

Although RNA-binding proteins (RBPs) coordinate many key decisions during cell growth and differentiation, the dynamics of RNA-RBP interactions have not been extensively studied on a global basis. We immunoprecipitated endogenous ribonucleoprotein complexes containing HuR and PABP throughout a T-cell activation time course and identified the associated mRNA populations using microarrays. We used Gaussian mixture modeling as a discriminative model, treating RBP association as a discrete variable (target or not target), and as a generative model, treating RBP-association as a continuous variable (probability of association). We report that HuR interacts with different populations of mRNAs during T-cell activation. These populations encode functionally related proteins that are members of the Wnt pathway and proteins mediating T-cell receptor signaling pathways. Moreover, the mRNA targets of HuR were found to overlap with the targets of other posttranscriptional regulatory factors, indicating combinatorial interdependence of posttranscriptional regulatory networks and modules after activation. Applying HuR mRNA dynamics as a quantitative phenotype in the drug-gene-phenotype Connectivity Map, we identified candidate small molecule effectors of HuR and T-cell activation. We show that one of these candidates, resveratrol, exerts T-cell activation-dependent posttranscriptional effects that are rescued by HuR. Thus, we describe a strategy to systematically link an RBP and condition-specific posttranscriptional effects to small molecule drugs.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:10273/STUB1
EntrezGene:1437/CSF2
EntrezGene:16842/Lef1
EntrezGene:1994/ELAVL1
EntrezGene:202/AIM1
EntrezGene:26986/PABPCP5
EntrezGene:29967/LRP12
EntrezGene:3320/HSP90AA2
EntrezGene:3930/LBR
EntrezGene:4665/NAB2
EntrezGene:4790/NFKB1
EntrezGene:51176/LEF1
EntrezGene:55124/PIWIL2
EntrezGene:6386/SDCBP
EntrezGene:64213/St7
EntrezGene:6764/ST5
EntrezGene:7073/TIAL1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:9698/PUM1

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000204490 0,1
TNF ENSG00000206439 0,1
TNF ENSG00000223952 0,1
TNF ENSG00000228321 0,1
TNF ENSG00000228849 0,1
TNF ENSG00000230108 0,1
TNF ENSG00000232810 0,1
CSF2 ENSG00000164400 2,3
ANP32A ENSG00000140350 4,5
NAB2 ENSG00000166886 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 HSCHR6_MHC_COX:31533103-31533290
0, 1 chr6:31545691-31545878
4, 5 chr15:69070920-69072420
0, 1 HSCHR6_MHC_QBL:31535934-31536121
0, 1 HSCHR6_MHC_DBB:31527835-31528022
0, 1 HSCHR6_MHC_APD:31557012-31557199
6, 7 chr12:57488503-57489253
0, 1 HSCHR6_MHC_MCF:31622000-31622187
2 chr5:131411693-131411713
0, 1 HSCHR6_MHC_MANN:31585178-31585365
0, 1 HSCHR6_MHC_SSTO:31535634-31535821

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2724974.pdf TCCAGATGTTTCCAGACTTC
1 PMC2724974.pdf TGAGCCAAGGCAGCTCCTAC
2 PMC2724974.pdf TGATACAGGCATGGCAGAAG
3 PMC2724974.pdf TACGGTAAAACATCTTGAATAAATATG
4 PMC2724974.pdf AGTGGAATAACCTATTTTGAAAAATTC
5 PMC2724974.pdf CATTCTTTTTACAATACGACAAACAAA
6 PMC2724974.pdf AGGGTTGGACTGGTGTCTTC
7 PMC2724974.pdf GCCATAAAATAAATTTTATTCCAAA
Display recognized sequences in FASTA format