text2genome

About us

Related Links

Press Coverage

PubMed: 9396817    PubMedCentral: PMC147127

Nested genetic bit analysis (N-GBA) for mutation detection in the p53 tumor suppressor gene.

Head SR, Rogers YH, Parikh K, Lan G, Anderson S, Goelet P, Boyce-Jacino MT
Nucleic acids research, 5065 , 1997

Abstract:

There is a growing and significant demand for reliable, simple and sensitive methods for repeated scanning of a given gene or gene fragment for detection and characterization of mutations. Solid-phase sequencing by single base primer extension of nested GBATM primers on miniaturized DNA arrays can be used to effectively scan targeted sequences for missense, insertion and deletion mutations. This paper describes the use of N-GBA arrays designed to scan the sequence of a 33 base region of exon 8 of the p53 gene (codons 272-282) encompassing a hot spot for mutations associated with the development of cancer. Synthetic DNA templates containing various missense, insertion and deletion mutations, as well as DNA prepared from pancreatic and biliary tumor cells, were genotyped using the exon 8 arrays.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:2629/GBA
EntrezGene:6711/SPTBN1
EntrezGene:672/BRCA1
EntrezGene:675/BRCA2
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,1

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr17:7577058-7577155

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC147127.pdf TGGTAATCTACTGGGACGGAACAGC
1 PMC147127.pdf CCCTTTCTTGCGGAGATTCTCTTCC
Display recognized sequences in FASTA format