text2genome

About us

Related Links

Press Coverage

PubMed: 18959789    PubMedCentral: PMC2584108

Genetic profile of Egyptian hepatocellular-carcinoma associated with hepatitis C virus Genotype 4 by 15 K cDNA microarray: preliminary study.

Zekri AR, Hafez MM, Bahnassy AA, Hassan ZK, Mansour T, Kamal MM, Khaled HM
BMC research notes, 106 , 2008

Abstract:

BACKGROUND: Hepatocellular carcinoma (HCC) is a preventable disease rather than a curable one, since there is no well-documented effective treatment modality until now, making the molecular study of this disease mandatory. FINDINGS: We studied gene expression profile of 17 Egyptian HCC patients associated with HCV genotype-4 infection by c-DNA microarray. Out of the 15,660 studied genes, 446 were differentially expressed; 180 of them were up regulated and 134 were down regulated. Seventeen genes out of the 180 up-regulated genes are involved in 28 different pathways. Protein phosphatase 3 (PPP3R1) is involved in 10 different pathways followed by fibroblast growth factor receptor 1 (FGFR1), Cas-Br-M ecotropic retroviral transforming sequence b (CBLB), spleen tyrosine kinase (SYK) involved in three pathways; bone morphogenetic protein 8a (BMP8A), laminin alpha 3 (LAMA3), cell division cycle 23 (CDC23) involved in 2 pathways and NOTCH4 which regulate Notch signaling pathway. On the other hand, 25 out of the 134 down-regulated genes are involved in 20 different pathways. Integrin alpha V alpha polypeptide antigen CD51 (ITGVA) is involved in 4 pathways followed by lymphotoxin alpha (TNF superfamily, member 1) (LTA) involved in 3 pathways and alpha-2-macroglobulin (A2M), phosphorylase kinase alpha 2-liver (PHKA2) and MAGI1 membrane associated guanylate kinase 1 (MAGI1) involved in 2 pathways. In addition, 22 genes showed significantly differential expression between HCC cases with cirrhosis and without cirrhosis. Confirmation analysis was performed on subsets of these genes by RT-PCR, including some up-regulated genes such as CDK4, Bax, NOTCH4 and some down-regulated genes such as ISGF3G, TNF, and VISA. CONCLUSION: This is the first preliminary study on gene expression profile in Egyptian HCC patients associated with HCV-Genotype-4 using the cDNA microarray. The identified genes could provide a new gate for prognostic and diagnostic markers for HCC associated with HCV. They could also be used to identify candidate genes for molecular target therapy.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Hepatitis C virus
Artocarpus hirsutus
Macacine herpesvirus 1
Hepatitis B virus
Homo sapiens
Medicago sativa
Felis catus
Bos taurus
Mus sp.
Rattus norvegicus
Prunus armeniaca
Schizosaccharomyces pombe
Saccharomyces cerevisiae
Genes found in fulltext (GNAT)
EntrezGene:2246/FGF1
EntrezGene:2260/FGFR1
EntrezGene:2268/FGR
EntrezGene:23586/DDX58
EntrezGene:3439/IFNA1
EntrezGene:3576/IL8
EntrezGene:3661/IRF3
EntrezGene:3909/LAMA3
EntrezGene:3914/LAMB3
EntrezGene:3918/LAMC2
EntrezGene:4049/LTA
EntrezGene:4049/LTA
EntrezGene:4049/LTA
EntrezGene:4089/SMAD4
EntrezGene:4091/SMAD6
EntrezGene:4851/NOTCH1
EntrezGene:4855/NOTCH4
EntrezGene:4855/NOTCH4
EntrezGene:4968/OGG1
EntrezGene:5256/PHKA2
EntrezGene:5535/PPP3R2
EntrezGene:57506/MAVS
EntrezGene:581/BAX
EntrezGene:596/BCL2
EntrezGene:64135/IFIH1
EntrezGene:6616/SNAP25
EntrezGene:6850/SYK
EntrezGene:7040/TGFB1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7157/TP53
EntrezGene:989/SEPT7

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
NOTCH4 ENSG00000204301 0,1
MAVS ENSG00000088888 2,3
CDK7 ENSG00000134058 4,5
TNF ENSG00000204490 7,8
TNF ENSG00000206439 7,8
TNF ENSG00000223952 7,8
TNF ENSG00000228321 7,8
TNF ENSG00000228849 7,8
TNF ENSG00000230108 7,8
TNF ENSG00000232810 7,8

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
7, 8 HSCHR6_MHC_COX:31531979-31532708
4, 5 chr5:68530784-68572995
1 HSCHR6_MHC_COX:32114941-32114965
1 HSCHR6_MHC_APD:32177808-32177832
9 chr8:130478585-130478606
2 chr20:3835272-3835291
1 HSCHR6_MHC_MANN:32205890-32205914
6 chr14:24632610-24632630
1 HSCHR6_MHC_MCF:32242893-32242917
7, 8 HSCHR6_MHC_QBL:31534810-31535539
7, 8 HSCHR6_MHC_DBB:31526711-31527440
7, 8 HSCHR6_MHC_SSTO:31534510-31535239
7, 8 HSCHR6_MHC_MCF:31620876-31621605
1 HSCHR6_MHC_SSTO:32173335-32173359
7, 8 chr6:31544567-31545296
1 HSCHR6_MHC_QBL:32124086-32124110
1 chr6:32166466-32166490
7, 8 HSCHR6_MHC_MANN:31584054-31584783
7, 8 HSCHR6_MHC_APD:31555888-31556617

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2584108.pdf GAGGACAGCATTGGTCTCAAGG
1 PMC2584108.pdf CAACTCCATCCTCATCAACTTCTG
2 PMC2584108.pdf TGCCGTTTGCTGAAGACAA
3 PMC2584108.pdf TTCGTCCGCGAGATCAACT
4 PMC2584108.pdf CGGGCTTTACGGCGCCGGATGG
5 PMC2584108.pdf CCCTCAGTAGTAAAATGTTGTCC
6 PMC2584108.pdf CATCAAAGCGACAGCACAGT
7 PMC2584108.pdf ACAAGCCTGTAGCCCATGTT
8 PMC2584108.pdf AAAGTAGACCTGCCCAGACT
9 PMC2584108.pdf CATGGAACTGATGATGATGAA
Display recognized sequences in FASTA format