text2genome

About us

Related Links

Press Coverage

PubMed: 17953482    PubMedCentral: PMC2034399

Influenza virus transmission is dependent on relative humidity and temperature.

Lowen AC, Mubareka S, Steel J, Palese P
PLoS pathogens, , 2007

Abstract:

Using the guinea pig as a model host, we show that aerosol spread of influenza virus is dependent upon both ambient relative humidity and temperature. Twenty experiments performed at relative humidities from 20% to 80% and 5 degrees C, 20 degrees C, or 30 degrees C indicated that both cold and dry conditions favor transmission. The relationship between transmission via aerosols and relative humidity at 20 degrees C is similar to that previously reported for the stability of influenza viruses (except at high relative humidity, 80%), implying that the effects of humidity act largely at the level of the virus particle. For infected guinea pigs housed at 5 degrees C, the duration of peak shedding was approximately 40 h longer than that of animals housed at 20 degrees C; this increased shedding likely accounts for the enhanced transmission seen at 5 degrees C. To investigate the mechanism permitting prolonged viral growth, expression levels in the upper respiratory tract of several innate immune mediators were determined. Innate responses proved to be comparable between animals housed at 5 degrees C and 20 degrees C, suggesting that cold temperature (5 degrees C) does not impair the innate immune response in this system. Although the seasonal epidemiology of influenza is well characterized, the underlying reasons for predominant wintertime spread are not clear. We provide direct, experimental evidence to support the role of weather conditions in the dynamics of influenza and thereby address a long-standing question fundamental to the understanding of influenza epidemiology and evolution.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1230/CCR1
EntrezGene:3665/IRF7
EntrezGene:6347/CCL2
EntrezGene:6352/CCL5
EntrezGene:6354/CCL7
EntrezGene:64135/IFIH1
EntrezGene:6772/STAT1

Best predicted genome from sequences: Cavia porcellus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
IL1B_CAVPO ENSCPOG00000001975 3,4
CCL5_CAVPO ENSCPOG00000008852 5,6
A3QRJ8_CAVPO ENSCPOG00000004929 7,8
TNFA_CAVPO ENSCPOG00000002343 9,10
ENSCPOG00000008191 11,12
CCL2_CAVPO ENSCPOG00000013468 11,12
Q9Z318_CAVPO ENSCPOG00000013035 13,14
Q8CGS0_CAVPO ENSCPOG00000011038 15,16

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
5, 6 scaffold_32:11381270-11381415
0 scaffold_30:10928908-10928928
4 scaffold_73:6554488-6554508
7, 8 scaffold_36:8357205-8357334
9, 10 scaffold_15:41352227-41352360
15, 16 scaffold_9:30503260-30503381
11, 12, 13, 14 scaffold_32:12657541-12710210

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2034399.pdf CTTCCTCTGTGGAGGAGTGG
1 PMC2034399.pdf GAGCCAGAGCTGATGAAGC
2 PMC2034399.pdf TCTTATGGCATACTCCTCTGG
3 PMC2034399.pdf GAAGAAGAGCCCATCGTCTG
4 PMC2034399.pdf CATGGGTCAGACAACACCAG
5 PMC2034399.pdf GCAATGCTAGCAGCTTCTCC
6 PMC2034399.pdf TTGCCTTGAAAGATGTGCTG
7 PMC2034399.pdf TAACCACGCACTCTGTTTGC
8 PMC2034399.pdf ACAGTATTGCGGGATCCAAG
9 PMC2034399.pdf TTCCGGGCAGATCTACTTTG
10 PMC2034399.pdf TGAACCAGGAGAAGGTGAGG
11 PMC2034399.pdf ATTGCCAAACTGGACCAGAG
12 PMC2034399.pdf CTACGGTTCTTGGGGTCTTG
13 PMC2034399.pdf TCATTGCAGTCCTTCTGTGC
14 PMC2034399.pdf TAGTCTCTGCACCCGAATCC
15 PMC2034399.pdf GACCTGAGCAAGACCCTGAG
16 PMC2034399.pdf TGGCTCAGAATGCAGAGATG
17 PMC2034399.pdf AAGGGGCCATCACATTCAC
18 PMC2034399.pdf CAAGAAACTTGCCCAGAAA
19 PMC2034399.pdf CAAACCCCGaGAGAAGAAG
20 PMC2034399.pdf TGCAAGGTGTACTGGGAGGT
21 PMC2034399.pdf TCACCAGGATCAGGGTCTTC
Display recognized sequences in FASTA format