text2genome

About us

Related Links

Press Coverage

PubMed: 18199331    PubMedCentral: PMC2374462

Anti-inflammatory effect of antidiabetic thiazolidinediones prevents bone resorption rather than cartilage changes in experimental polyarthritis.

Koufany M, Moulin D, Bianchi A, Muresan M, Sebillaud S, Netter P, Weryha G, Jouzeau JY
Arthritis research & therapy, R6 , 2008

Abstract:

BACKGROUND: Rosiglitazone and pioglitazone are high-affinity peroxisome proliferator-activated receptor (PPAR)-gamma agonists with potent anti-diabetic properties and potential anti-inflammatory effects. We compared the ability of a range of oral doses of these thiazolidinediones, including those sufficient to restore insulin sensitization, to inhibit the pathogenesis of adjuvant-induced arthritis (AIA). METHODS: AIA was induced in Lewis rats by a subcutaneous injection of 1 mg of complete Freund's adjuvant. Rats were treated orally for 21 days with pioglitazone 3, 10 or 30 mg/kg/day, rosiglitazone 3 or 10 mg/kg/day, or with vehicle only. The time course of AIA was evaluated by biotelemetry to monitor body temperature and locomotor activity, by clinical score and plethysmographic measurement of hindpaw oedema. At necropsy, RT-PCR analysis was performed on synovium, liver and subcutaneous fat. Changes in cartilage were evaluated by histological examination of ankle joints, radiolabelled sulphate incorporation (proteoglycan synthesis), glycosaminoglycan content (proteoglycan turnover) and aggrecan expression in patellar cartilage. Whole-body bone mineral content was measured by dual-energy X-ray absorptiometry. RESULTS: The highest doses of rosiglitazone (10 mg/kg/day) or pioglitazone (30 mg/kg/day) were required to reduce fever peaks associated with acute or chronic inflammation, respectively, and to decrease arthritis severity. At these doses, thiazolidinediones reduced synovitis and synovial expression of TNF-alpha, IL-1beta and basic fibroblast growth factor without affecting neovascularization or the expression of vascular endothelial growth factor. Thiazolidinediones failed to prevent cartilage lesions and arthritis-induced inhibition of proteoglycan synthesis, aggrecan mRNA level or glycosaminoglycan content in patellar cartilage, but reduced bone erosions and inflammatory bone loss. A trend towards lower urinary levels of deoxipyridinolin was also noted in arthritic rats treated with thiazolidinediones. Rosiglitazone 10 mg/kg/day or pioglitazone 30 mg/kg/day increased the expression of PPAR-gamma and adiponectin in adipose tissue, confirming that they were activating PPAR-gamma in inflammatory conditions, although an increase in fat mass percentage was observed for the most anti-arthritic dose. CONCLUSION: These data emphasize that higher dosages of thiazolidinediones are required for the treatment of arthritis than for restoring insulin sensitivity but that thiazolidinediones prevent inflammatory bone loss despite exposing animals to increased fatness possibly resulting from excessive activation of PPAR-gamma.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:117516/TNF11_RAT
EntrezGene:16193/Il6
EntrezGene:21926/Tnf
EntrezGene:24835/TNFA_RAT
EntrezGene:25341/TR11B_RAT
EntrezGene:54250/FGF2_RAT
EntrezGene:58968/PGCA_RAT
EntrezGene:83785/VEGFA_RAT

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
RL27_RAT ENSRNOG00000020674 0,1
CCL2_RAT ENSRNOG00000007159 2,3
FGF2_RAT ENSRNOG00000017392 4,5
VEGFA_RAT ENSRNOG00000019598 6,7
TNFA_RAT ENSRNOG00000000837 8,9
IL1B_RAT ENSRNOG00000004649 11,10
RS29_RAT ENSRNOG00000004196 12,13
RS29_RAT ENSRNOG00000028939 12,13
PGCA_RAT ENSRNOG00000028992 14,15
PPARA_RAT ENSRNOG00000021463 16,17
PPARG_RAT ENSRNOG00000008839 18,19
NP_653345.1 ENSRNOG00000001821 20,21
ACOX1_RAT ENSRNOG00000008755 22,23

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
12, 13 chr3:142339696-142339769
0, 1 chrX:87227183-87227408
18 chr4:151551246-151551267
14, 15 chr1:134836241-134842881
2, 3 chr10:70257092-70257599
0, 1 chr15:42051656-42051879
16, 17 chr7:123771574-123771632
0, 1 chr17:24023899-24024124
10, 11 chr3:116964888-116967148
20 chr11:79910997-79911017
8 chr20:3661166-3661186
6, 7 chr9:10527700-10530725
12, 13 chr2:35547874-35547947
0, 1 chr20:28894698-28894916
4, 5 chr2:123936401-123947067
0, 1 chr8:78734438-78734663
22 chr10:106289178-106289199
12, 13 chr13:89015693-89015766
0, 1 chr1:191978213-191978443
0, 1 chr11:63683084-63683306

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2374462.pdf TCCTGGCTGGACGCTACTC
1 PMC2374462.pdf CCACAGAGTACCTTGTGGGC
2 PMC2374462.pdf ATGCAGTTAATGCCCCACTC
3 PMC2374462.pdf TTCCTTATTGGGGTCAGCAC
4 PMC2374462.pdf GAACCGGTACCTGGCTATGA
5 PMC2374462.pdf CCGTTTTGGATCCGAGTTTA
6 PMC2374462.pdf CAATGATGAAGCCCTGGAGT
7 PMC2374462.pdf TTTCTTGCGCTTTCGTTTTT
8 PMC2374462.pdf AGATGTGGAACTGGCAGAGG
9 PMC2374462.pdf CCCATTTGGGAACTTCTCCT
10 PMC2374462.pdf TGAAAGCTCTCCACCTCAATGG
11 PMC2374462.pdf TCCATGGTGAAGTCAACTATGTCC
12 PMC2374462.pdf AAGATGGGTCACCAGCAGCTCTACTG
13 PMC2374462.pdf AGACGCGGCAAGAGCGAGAA
14 PMC2374462.pdf ACACCCCTACCCTTGCTTCT
15 PMC2374462.pdf AAAGTGTCCAAGGCATCCAC
16 PMC2374462.pdf GATGACCTGGAAAGTCCCTT
17 PMC2374462.pdf CTTGAATGTTTCCCATCTCTT
18 PMC2374462.pdf ATGGGTGAAACTCTGGGAGAT
19 PMC2374462.pdf GGTAATTTCTTGTGAAGTGCT
20 PMC2374462.pdf AATCCTGCCCAGTCATGAAG
21 PMC2374462.pdf TCTCCAGGAGTGCCATCTCT
22 PMC2374462.pdf CCAATCACGCAATAGTTCTGG
23 PMC2374462.pdf CGCTGTATCGTATGGCGAT
Display recognized sequences in FASTA format