text2genome

About us

Related Links

Press Coverage

PubMed: 15254253    PubMedCentral: PMC484203

Preparation of DNA-modified nanoparticles and preliminary study for colorimetric SNP analysis using their selective aggregations.

Ihara T, Tanaka S, Chikaura Y, Jyo A
Nucleic acids research, e105 , 2004

Abstract:

DNA-modified nanospheres were prepared by anchoring amino-terminated oligodeoxynucleotides (ODNs) with carboxylates onto a colored polystyrene sphere surface through amido bonds. About 220 ODN molecules were immobilized onto a nanosphere 40 nm in diameter. Preliminary studies using the microspheres with 1 microm diameter reveal that the specificity of hybridization was retained after modification. Three kinds of differently colored (RGB, red/green/blue) nanospheres bearing unique ODNs on their surface were prepared for detecting the p53 gene. Each ODN is complementary to a different part in the 45mer sample that is a part of a conservative region of the p53 gene containing one of the hot spots. In a binary system using spheres R and G, the wild-type 45mer made the aggregates with yellow emission as the result of mixing both colors. The mutant 45mer containing one nucleotide displacement did not give such aggregates with distinct colors. The study of fluorescence resonance energy transfer (FRET) showed that spheres R and G directly contact each other in the aggregates with the wild type. The RGB ternary system gave aggregates with specific colors corresponding to the added ODN samples, wild type or mutant. In addition, in the presence of both samples, all of the spheres formed aggregates with white emission as a consequence of mixing three primary colors of light. This means that the present technique should allow us to conduct an allele analysis.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:860/RUNX2
EntrezGene:9129/PRPF3

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,1

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0 chr17:7577527-7577572

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC484203.pdf AGGATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCAGT
1 PMC484203.pdf ATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGTCCCATC
2 PMC484203.pdf TTTTTTTTTTGATGGGCCTCCGGTT
3 PMC484203.pdf TTTTTTTTTTGATGGGACTCCGGTT
4 PMC484203.pdf GGAACTGTTACACATTTTTTTTTTT
Display recognized sequences in FASTA format