text2genome

About us

Related Links

Press Coverage

PubMed: 19190733    PubMedCentral: PMC2633460

Inflammatory cytokine expression on the ocular surface in the Botulium toxin B induced murine dry eye model.

Zhu L, Shen J, Zhang C, Park CY, Kohanim S, Yew M, Parker JS, Chuck RS
Molecular vision, 250 , 2009

Abstract:

PURPOSE: Inflammation plays an important role in dry eye syndrome. In this study, inflammatory cytokine expression on the ocular surface in the Botulium toxin B (BTX-B) induced mouse dry eye model was investigated. METHODS: CBA/J mice received an injection of saline or 20 milliunits (mU) of BTX-B into the lacrimal gland. Tear production and corneal fluorescein staining were evaluated in all groups before injection and at 3 time points after. The pro-inflammatory cytokines macrophage inhibitory factor (MIF), interleukin-1beta (IL-1 beta), tumor necrosis factor-alpha (TNF- alpha) and interleukin-6 (IL-6) in conjunctival and corneal epithelium were evaluated by real time quantitative PCR and immunohistochemistry. RESULTS: BTX-B injected mice showed significantly decreased aqueous tear production and increased corneal fluorescein staining at the 1 week and 2 week time points compared with normal control and saline-injected mice. The BTX-B injected mice mRNA expression levels of TNF-alpha and IL-1beta from conjunctival and corneal epithelial cells increased significantly at two early time points comparing with that of normal and saline injected mice, but IL-1beta returned to normal levels at the 4 week time point. Saline injected mice showed no difference in mRNA expression of TNF-alpha, IL-1beta, MIF, and IL-6 on the ocular surface tissue at all time points. Immunohistochemistry confirmed these findings. CONCLUSIONS: BTX-B induced mouse model showed decreased aqueous tear production, increased corneal fluorescein staining, and TNF-alpha and IL-1beta increased expression on the ocular surface within one month. The patterns seen appeared to mimic those in humans with non-Sjögren's syndrome keratoconjunctivitis sicca (NS-KCS).

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:16193/Il6
EntrezGene:17319/Mif
EntrezGene:21926/Tnf
EntrezGene:3569/IL6
EntrezGene:3586/IL10
EntrezGene:381970/Abpe
EntrezGene:4282/MIF
EntrezGene:4858/NOVA2
EntrezGene:5599/MAPK8
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:958/CD40

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr5:30339928-30341391
0, 1 chr10:75322464-75322871
0, 1 chr17:35338035-35338755
0, 1 chr2:129191766-129193145
0, 1 chr7:30750336-30750542

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2633460.pdf GCCCATCCTCTGTGACTCATGAACTGGCAGAAGAGGCACTGTGCCAGAGGGGTTTCTGTAGTTGCCTTCTTGGGACTGACAGACGCCACTGTCGCTTT
1 PMC2633460.pdf AGGCCACAGGTATTTTGTCGAGGGTCTGGGCCATAGAACTAGGCCACACAGCAGCTTACTCAGAATTGCCATTGCACAACTGTCTTTGGAACTTTGTCGCAA
Display recognized sequences in FASTA format