text2genome

About us

Related Links

Press Coverage

PubMed: 19779605    PubMedCentral: PMC2744869

SOCS2 influences LPS induced human monocyte-derived dendritic cell maturation.

Hu J, Winqvist O, Flores-Morales A, Wikström AC, Norstedt G
PloS one, , 2009

Abstract:

Dendritic cells (DCs) are highly specific antigen presenting cells, which link innate and adaptive immune responses and participate in protecting hosts from invading pathogens. DCs can be generated in vitro by culturing human monocytes with GM-CSF and IL-4 followed by LPS induced DC maturation. We set out to study the suppressor of cytokine signaling (SOCS) proteins during maturation and activation of human monocyte-derived DCs from peripheral blood in vitro. We found that the expression of SOCS2 mRNA and protein is dramatically up-regulated during DC maturation. Silencing of SOCS2 using siRNA, inhibited DC maturation as evidenced by a decreased expression of maturation markers such as CD83, co-stimulatory molecules CD40, CD86 and HLA-DR. Furthermore, silencing of SOCS2 decreased LPS induced activation of MAP kinases (SAKP/JNK, p38, ERK), IRF3, decreased the translocation of the NF-kappaB transcription factor and reduced downstream gene mRNA expression. These results suggest a role for SOCS2 in the MyD88-dependent and -independent TLR4 signaling pathways. In conclusion, our results demonstrate that SOCS2 is required for appropriate TLR4 signaling in maturating human DCs via both the MyD88-dependent and -independent signaling pathway.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:4615/MYD88
EntrezGene:7099/TLR4
EntrezGene:8835/SOCS2
Genes found in fulltext (GNAT)
EntrezGene:114609/TIRAP
EntrezGene:1154/CISH
EntrezGene:12700/Cish
EntrezGene:12702/Socs3
EntrezGene:1432/MAPK14
EntrezGene:1437/CSF2
EntrezGene:216233/Socs2
EntrezGene:353376/TICAM2
EntrezGene:3565/IL4
EntrezGene:3661/IRF3
EntrezGene:4615/MYD88
EntrezGene:5599/MAPK8
EntrezGene:59067/IL21
EntrezGene:7099/TLR4
EntrezGene:7187/TRAF3
EntrezGene:84676/TRIM63
EntrezGene:8651/SOCS1
EntrezGene:8835/SOCS2
EntrezGene:9021/SOCS3
EntrezGene:942/CD86
EntrezGene:958/CD40

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
CISH ENSG00000114737 0,1
SOCS2 ENSG00000120833 3,4
SOCS3 ENSG00000184557 5,6
SOCS4 ENSG00000180008 7,8
SOCS5 ENSG00000171150 9,10
TNF ENSG00000206439 12,13
TNF ENSG00000223952 12,13
TNF ENSG00000228321 12,13
TNF ENSG00000230108 12,13
TNF ENSG00000232810 12,13
TNF ENSG00000228849 13,12
IL1B ENSG00000125538 14,15
IL6 ENSG00000136244 16,17
CCL4L1 ENSG00000205020 18,19
IFNB1 ENSG00000171855 20,21

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2 chr16:11348653-11348673
24 chr17:7414872-7414891
5, 6 chr17:76355022-76355173
20, 21 chr9:21077690-21077786
12 HSCHR6_MHC_COX:31531064-31531083
18, 19 chr17:34538552-34539226
18, 19 chr17:34640118-34640792
11 chr18:67992719-67992739
7, 8 chr14:55510092-55510183
12 HSCHR6_MHC_MANN:31583139-31583158
22, 23 chr4:76927368-76943594
4 chr20:31775447-31775468
16, 17 chr7:22767173-22768355
15 chr2:113591089-113591110
0, 1 chr3:50645809-50645962
12 chr6:31543652-31543671
4 chr12:93968616-93968637
9, 10 chr2:46986697-46986788
12 HSCHR6_MHC_QBL:31533893-31533912
12 HSCHR6_MHC_SSTO:31533595-31533614

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2744869.S2.doc AACTGCCCAAGCCAGTCAT
1 PMC2744869.S2.doc CCCGAAGGTAGGAGAAGGTC
2 PMC2744869.S2.doc AACACGGCATCCCAGTTAAT
3 PMC2744869.S2.doc GAGCTCGGTCAGACAGGATG
4 PMC2744869.S2.doc AGTTGGTCCAGCTGATGTTTT
5 PMC2744869.S2.doc GTCACCCACAGCAAGTTTCC
6 PMC2744869.S2.doc TCACTGCGCTCCAGTAGAAG
7 PMC2744869.S2.doc CACTCTTCAGGGCTTCCGTC
8 PMC2744869.S2.doc AGGCTAAATCTGATCGAGGTGG
9 PMC2744869.S2.doc ATCTGGAGACAGCCATACCCA
10 PMC2744869.S2.doc CAAATCAGGCACGAGGCAGT
11 PMC2744869.S2.doc CCTAGTTGTCGCCCCAGAGA
12 PMC2744869.S2.doc CACGCTCTTCTGCCTGCTG
13 PMC2744869.S2.doc GATGATCTGACTGCCTGGGC
14 PMC2744869.S2.doc ACAGATGAAGTGCTCCTTCCA
15 PMC2744869.S2.doc GTCGGAGATTCGTAGCTGGAT
16 PMC2744869.S2.doc GACAGCCACTCACCTCTTCA
17 PMC2744869.S2.doc AGTGCCTCTTTGCTGCTTTC
18 PMC2744869.S2.doc TGCGTGACTGTCCTGTCTCT
19 PMC2744869.S2.doc TTCCTCGCGGTGTAAGAAA
20 PMC2744869.S2.doc GATTCCTACAAAGAAGCAGCAA
21 PMC2744869.S2.doc CAAAGTTCATCCTGTCCTTGAG
22 PMC2744869.S2.doc GCACCAACCAAGGGACTATC
23 PMC2744869.S2.doc CAGACATCTCTTCTCACCCTTCT
24 PMC2744869.S2.doc GCACCACGTCCAATGACAT
Display recognized sequences in FASTA format