text2genome

About us

Related Links

Press Coverage

PubMed: 17183718    PubMedCentral: PMC1762388

Modulation of T cell function by combination of epitope specific and low dose anticytokine therapy controls autoimmune arthritis.

Roord ST, Zonneveld-Huijssoon E, Le T, Yung GP, Koffeman E, Ronaghy A, Ghahramani N, Lanza P, Billetta R, Prakken BJ, Albani S
PloS one, , 2006

Abstract:

Innate and adaptive immunity contribute to the pathogenesis of autoimmune arthritis by generating and maintaining inflammation, which leads to tissue damage. Current biological therapies target innate immunity, eminently by interfering with single pro-inflammatory cytokine pathways. This approach has shown excellent efficacy in a good proportion of patients with Rheumatoid Arthritis (RA), but is limited by cost and side effects. Adaptive immunity, particularly T cells with a regulatory function, plays a fundamental role in controlling inflammation in physiologic conditions. A growing body of evidence suggests that modulation of T cell function is impaired in autoimmunity. Restoration of such function could be of significant therapeutic value. We have recently demonstrated that epitope-specific therapy can restore modulation of T cell function in RA patients. Here, we tested the hypothesis that a combination of anti-cytokine and epitope-specific immunotherapy may facilitate the control of autoimmune inflammation by generating active T cell regulation. This novel combination of mucosal tolerization to a pathogenic T cell epitope and single low dose anti-TNFalpha was as therapeutically effective as full dose anti-TNFalpha treatment. Analysis of the underlying immunological mechanisms showed induction of T cell immune deviation.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:12477/Ctla4
EntrezGene:1493/CTLA4
EntrezGene:24660/PMP22_RAT
EntrezGene:2597/GAPDH
EntrezGene:3329/HSPD1
EntrezGene:3559/IL2RA
EntrezGene:3565/IL4
EntrezGene:3586/IL10
EntrezGene:50943/FOXP3
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7133/TNFRSF1B
EntrezGene:788/SLC25A20
EntrezGene:847/CAT
EntrezGene:920/CD4

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
IL10_RAT ENSRNOG00000004647 0,1
TNFA_RAT ENSRNOG00000000837 2,3,4
NP_001101720.1 ENSRNOG00000011702 5,6
G3P_RAT ENSRNOG00000018630 7,8,9

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3, 4 chr20:3662509-3662575
5, 6 chrX:26952514-26952556
0, 1 chr13:43953902-43953950
7, 8, 9 chr16:25751333-25751402
7, 8, 9 chr5:117080414-117080483
7, 8, 9 chr4:161283693-161283762

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1762388.pdf GCCTGGCTCAGCACTGCTAT
1 PMC1762388.pdf TTGCCTGCTCTTACTGGCTGGAGTGAA
2 PMC1762388.pdf ACAAGGCTGCCCCGACTAC
3 PMC1762388.pdf TCCTGGTATGAAATGGCAAACC
4 PMC1762388.pdf TGCTCCTCACCCACACCGTCAGC
5 PMC1762388.pdf CCATTGGTTCACACGCATGT
6 PMC1762388.pdf CGCCTACTTCAGAAACCACCC
7 PMC1762388.pdf TGACTCTACCCACGGCAAGTT
8 PMC1762388.pdf TTCCCGTTGATGACCAGCTT
9 PMC1762388.pdf ACGGCACAGTCAAGGCTGAGAATGG
Display recognized sequences in FASTA format