text2genome

About us

Related Links

Press Coverage

PubMed: 19038023    PubMedCentral: PMC2612679

Proinflammatory effect in whole blood by free soluble bacterial components released from planktonic and biofilm cells.

Oscarsson J, Karched M, Thay B, Chen C, Asikainen S
BMC microbiology, 206 , 2008

Abstract:

BACKGROUND: Aggregatibacter actinomycetemcomitans is an oral bacterium associated with aggressive forms of periodontitis. Increasing evidence points to a link between periodontitis and cardiovascular diseases, however, the underlying mechanisms are poorly understood. This study investigated the pathogenic potential of free-soluble surface material, released from live planktonic and biofilm A. actinomycetemcomitans cells. RESULTS: By employing an ex vivo insert model (filter pore size 20 nm) we demonstrated that the A. actinomycetemcomitans strain D7S and its derivatives, in both planktonic and in biofilm life-form, released free-soluble surface material independent of outer membrane vesicles. This material clearly enhanced the production of several proinflammatory cytokines (IL-1 beta, TNF-alpha, IL-6, IL-8, MIP-1 beta) in human whole blood, as evidenced by using a cytokine antibody array and dissociation-enhanced-lanthanide-fluorescent-immunoassay. In agreement with this, quantitative real-time PCR indicated a concomitant increase in transcription of each of these cytokine genes. Experiments in which the LPS activity was blocked with polymyxin B showed that the stimulatory effect was only partly LPS-dependent, suggesting the involvement of additional free-soluble factors. Consistent with this, MALDI-TOF-MS and immunoblotting revealed release of GroEL-like protein in free-soluble form. Conversely, the immunomodulatory toxins, cytolethal distending toxin and leukotoxin, and peptidoglycan-associated lipoprotein, appeared to be less important, as evidenced by studying strain D7S cdt/ltx double, and pal single mutants. In addition to A. actinomycetemcomitans a non-oral species, Escherichia coli strain IHE3034, tested in the same ex vivo model also released free-soluble surface material with proinflammatory activity. CONCLUSION: A. actinomycetemcomitans, grown in biofilm and planktonic form, releases free-soluble surface material independent of outer membrane vesicles, which induces proinflammatory responses in human whole blood. Our findings therefore suggest that release of surface components from live bacterial cells could constitute a mechanism for systemic stimulation and be of particular importance in chronic localized infections, such as periodontitis.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1401/CRP
EntrezGene:17339/Mip
EntrezGene:3329/HSPD1
EntrezGene:3569/IL6
EntrezGene:3576/IL8
EntrezGene:4284/MIP
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
ACTB ENSG00000075624 4,5
IL1B ENSG00000125538 6,7
IL6 ENSG00000136244 9,8
IL8 ENSG00000169429 10,11
CCL4 ENSG00000129277 12,13
TNF ENSG00000204490 14,15
TNF ENSG00000206439 14,15
TNF ENSG00000223952 14,15
TNF ENSG00000228321 14,15
TNF ENSG00000228849 14,15
TNF ENSG00000230108 14,15
TNF ENSG00000232810 14,15

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
7 chr2:113591089-113591110
14, 15 chr6:31544313-31544584
14, 15 HSCHR6_MHC_SSTO:31534256-31534527
14, 15 HSCHR6_MHC_APD:31555634-31555905
12, 13 chr17:34432620-34432934
14, 15 HSCHR6_MHC_MANN:31583800-31584071
4, 5 chr7:5567482-5567684
14, 15 HSCHR6_MHC_MCF:31620622-31620893
10, 11 chr4:74607344-74607749
14, 15 HSCHR6_MHC_COX:31531725-31531996
8, 9 chr7:22767174-22768354
14, 15 HSCHR6_MHC_QBL:31534556-31534827
14, 15 HSCHR6_MHC_DBB:31526457-31526728

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2612679.pdf GGAGGCGATAACTCTACATCAGG
1 PMC2612679.pdf GTGTCACGTCGTCAAGCCGATG
2 PMC2612679.pdf CTACTACGGGACCTGTCGCAGG
3 PMC2612679.pdf CCGGCTTTAGTAGCATTACGACCG
4 PMC2612679.pdf GGATGCAGAAGGAGATCACTG
5 PMC2612679.pdf CGATCCACACGGAGTACTTG
6 PMC2612679.pdf ACAGATGAAGTGCTCCTTCCA
7 PMC2612679.pdf GTCGGAGATTCGTAGCTGGAT
8 PMC2612679.pdf ACAGCCACTCACCTCTTCAG
9 PMC2612679.pdf GTGCCTCTTTGCTGCTTTCAC
10 PMC2612679.pdf GAACTGAGAGTGATTGAGAGTGGA
11 PMC2612679.pdf CTCTTCAAAAACTTCTCCACAACC
12 PMC2612679.pdf CCAAACCAAAAGAAGCAAGC
13 PMC2612679.pdf AGAAACAGTGACAGTGGACC
14 PMC2612679.pdf CCCAGGGACCTCTCTCTAATC
15 PMC2612679.pdf ATGGGCTACAGGCTTGTCACT
Display recognized sequences in FASTA format