text2genome

About us

Related Links

Press Coverage

PubMed: 19197353    PubMedCentral: PMC2629572

Genetic mechanisms in Apc-mediated mammary tumorigenesis.

Kuraguchi M, Ohene-Baah NY, Sonkin D, Bronson RT, Kucherlapati R
PLoS genetics, , 2009

Abstract:

Many components of Wnt/beta-catenin signaling pathway also play critical roles in mammary tumor development, yet the role of the tumor suppressor gene APC (adenomatous polyposis coli) in breast oncongenesis is unclear. To better understand the role of Apc in mammary tumorigenesis, we introduced conditional Apc mutations specifically into two different mammary epithelial populations using K14-cre and WAP-cre transgenic mice that express Cre-recombinase in mammary progenitor cells and lactating luminal cells, respectively. Only the K14-cre-mediated Apc heterozygosity developed mammary adenocarcinomas demonstrating histological heterogeneity, suggesting the multilineage progenitor cell origin of these tumors. These tumors harbored truncation mutation in a defined region in the remaining wild-type allele of Apc that would retain some down-regulating activity of beta-catenin signaling. Activating mutations at codons 12 and 61 of either H-Ras or K-Ras were also found in a subset of these tumors. Expression profiles of acinar-type mammary tumors from K14-cre; Apc(CKO/+) mice showed luminal epithelial gene expression pattern, and clustering analysis demonstrated more correlation to MMTV-neu model than to MMTV-Wnt1. In contrast, neither WAP-cre-induced Apc heterozygous nor homozygous mutations resulted in predisposition to mammary tumorigenesis, although WAP-cre-mediated Apc deficiency resulted in severe squamous metaplasia of mammary glands. Collectively, our results suggest that not only the epithelial origin but also a certain Apc mutations are selected to achieve a specific level of beta-catenin signaling optimal for mammary tumor development and explain partially the colon- but not mammary-specific tumor development in patients that carry germline mutations in APC.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Mus musculus
Mouse mammary tumor virus
Homo sapiens
Mus sp.
Equus caballus
Taxus cuspidata
Caenorhabditis elegans
Saccharomyces cerevisiae
Rattus norvegicus
Escherichia coli
Gallus gallus
Eragrostis tef
Xenopus laevis
Schizosaccharomyces pombe
Poliovirus
Human immunodeficiency virus
Hepatitis B virus
Haemophilus influenzae
Puma concolor
Mycteroperca microlepis
Strongylocentrotus purpuratus
Mus musculus wagneri
Theobroma cacao
Mus musculus domesticus
Drosophila melanogaster
Human immunodeficiency virus 1
Viral hemorrhagic septicemia virus
Cricetulus griseus
Emericella nidulans
Frog erythrocytic virus
Alocasia macrorrhizos
Hepatitis A virus
Equus asinus
Prunus armeniaca
Avena sativa
Merluccius merluccius
Arachis hypogaea
Limulus polyphemus
Capparis spinosa
Sus scrofa
Avian sarcoma virus CT10
Mus musculus castaneus
Murine leukemia virus
Rat sarcoma virus
Spleen focus-forming virus
Arabidopsis thaliana
Apis mellifera
Pleuronichthys coenosus
Aquifex aeolicus
Broussonetia papyrifera
Neovison vison
Danio rerio
Felis catus
Annona squamosa
Avian erythroblastosis virus E26
Fragaria x ananassa
Avian erythroblastosis virus
Bacillus anthracis
Vaccinia virus
Helix pomatia
Murine hepatitis virus
Simian virus 40
Chicken anemia virus
Citrus medica
Avian myeloblastosis-associated virus
Mycobacterium avium complex
Myeloproliferative leukemia virus
Spondias purpurea
Pisum sativum
Clostridium novyi
Genes found in fulltext (GNAT)
EntrezGene:11789/Apc
EntrezGene:13866/Erbb2
EntrezGene:17826/Mtvr2
EntrezGene:18861/Pms2
EntrezGene:2064/ERBB2
EntrezGene:22373/Wap
EntrezGene:2348/FOLR1
EntrezGene:3172/HNF4A
EntrezGene:324/APC
EntrezGene:3265/HRAS
EntrezGene:3861/KRT14
EntrezGene:4609/MYC
EntrezGene:4758/NEU1
EntrezGene:4758/NEU1
EntrezGene:4758/NEU1
EntrezGene:4758/NEU1
EntrezGene:4758/NEU1
EntrezGene:4758/NEU1
EntrezGene:4758/NEU1
EntrezGene:4758/NEU1
EntrezGene:672/BRCA1
EntrezGene:675/BRCA2
EntrezGene:7157/TP53
EntrezGene:8626/TP63

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Apc ENSMUSG00000005871 0,2
Trp53 ENSMUSG00000059552 3,4,5,6
Kras ENSMUSG00000030265 11,12

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
11, 18, 19, 20 chr6:145195166-145195432
15, 16 chr7:148378689-148378908
6 chr11:69403298-69403317
0, 1, 2 chr18:34470826-34474848

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2629572.pdf CACTCAGAGAGTGGGCCTAAGCAGGATGTAGAATTAAGAATCCCTCCAGTTCAGGAAAACGTTCAGGAAAACGACAATGTTCAGGAAAACGACAATGTTCAGGAAAACGACAATAATGGGACCTGTGCAGCCTGAGGAATCAAATTCAAATGAAAACCAGGATTCAAATGAAAACCAGGATTCAAATGAAAACCAGGATCAGGATAAAGAGGTAGAAAAAGAGGTAGAAAAGCCTGAGGTAGAAAAGCCTGACGAAAAAGACTGATTCTGAAAAAGACTTATTATCTGATGACGATGATATTTCTGATGACGATGATATTTCTGATGACGATGATATTTCTGATGACGATGATATTGATGATATTGAAATATTA
1 PMC2629572.pdf CATTCTCCCCTACTTAGATGG
2 PMC2629572.pdf GTTGTCATCCAGGTCTGGTG
3 PMC2629572.S4.doc GTCTGTTATGTGCACGTACTC
4 PMC2629572.S4.doc GCACGTACTCTCCTCCCCT
5 PMC2629572.S4.doc AGGTGGGCAGCGCTCTCTT
6 PMC2629572.S4.doc GAGAGGCGCTTGTGCAGGT
7 PMC2629572.S4.doc TGATCTGCTCCCTGTACTGAT
8 PMC2629572.S4.doc ATGTCCTGAGCCTGGTGTCAT
9 PMC2629572.S4.doc GCAATTAACCCTCACTAAAGGGCAGTCGCGCCAGCAAGCT
10 PMC2629572.S4.doc AAGCTAATACGACTCACTATAGGGTGATCTGCTCCCTGTACTGAT
11 PMC2629572.S4.doc CCTGCTGAAAATGACTGAGTAT
12 PMC2629572.S4.doc TTAATTTGTTCTCTATAATGGTGAAT
13 PMC2629572.S4.doc GCAATTAACCCTCACTAAAGGGCCTGCTGAAAATGACTGAGTATT
14 PMC2629572.S4.doc AAGCTAATACGACTCACTATAGGGTTAATTTGTTCTCTATAATGGTGAA
15 PMC2629572.S4.doc CTTGGCTAAGTGTGCTTCTCA
16 PMC2629572.S4.doc ACTGCCACAGCCCACCTCT
17 PMC2629572.S4.doc CACCTCTGGCAGGTAGGCA
18 PMC2629572.S4.doc CACACAAAGGTGAGTGTTAAAAT
19 PMC2629572.S4.doc CTTTACAAGCGCACGCAGAC
20 PMC2629572.S4.doc CTGGCTGCCGTCCTTTACAA
21 PMC2629572.S7.xls CCTCCTCCTCCTCCTCCTCCTA
Display recognized sequences in FASTA format