text2genome

About us

Related Links

Press Coverage

PubMed: 19114593    PubMedCentral: PMC2606961

Coordinated control of self-renewal and differentiation of neural stem cells by Myc and the p19ARF-p53 pathway.

Nagao M, Campbell K, Burns K, Kuan CY, Trumpp A, Nakafuku M
The Journal of cell biology, 1243 , 2008

Abstract:

The modes of proliferation and differentiation of neural stem cells (NSCs) are coordinately controlled during development, but the underlying mechanisms remain largely unknown. In this study, we show that the protooncoprotein Myc and the tumor suppressor p19(ARF) regulate both NSC self-renewal and their neuronal and glial fate in a developmental stage-dependent manner. Early-stage NSCs have low p19(ARF) expression and retain a high self-renewal and neurogenic capacity, whereas late-stage NSCs with higher p19(ARF) expression possess a lower self-renewal capacity and predominantly generate glia. Overexpression of Myc or inactivation of p19(ARF) reverts the properties of late-stage NSCs to those of early-stage cells. Conversely, inactivation of Myc or forced p19(ARF) expression attenuates self-renewal and induces precocious gliogenesis through modulation of the responsiveness to gliogenic signals. These actions of p19(ARF) in NSCs are mainly mediated by p53. We propose that opposing actions of Myc and the p19(ARF)-p53 pathway have important functions in coordinated developmental control of self-renewal and cell fate choices in NSCs.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1029/CDKN2A
EntrezGene:12367/Casp3
EntrezGene:12578/Cdkn2a
EntrezGene:1270/CNTF
EntrezGene:12803/Cntf
EntrezGene:13645/Egf
EntrezGene:15228/Foxg1
EntrezGene:17869/Myc
EntrezGene:18109/Mycn
EntrezGene:1950/EGF
EntrezGene:20848/Stat3
EntrezGene:22059/Trp53
EntrezGene:24383/G3P_RAT
EntrezGene:24577/MYC_RAT
EntrezGene:24842/P53_RAT
EntrezGene:25163/CD2A1_RAT
EntrezGene:2597/GAPDH
EntrezGene:2670/GFAP
EntrezGene:3897/L1CAM
EntrezGene:4609/MYC
EntrezGene:4613/MYCN
EntrezGene:56246/MRAP
EntrezGene:57120/GOPC
EntrezGene:648/BMI1
EntrezGene:6774/STAT3
EntrezGene:6929/TCF3
EntrezGene:7157/TP53

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
MYC_RAT ENSRNOG00000004500 0,1,16,17
Q6TLI1_RAT ENSRNOG00000014259 4,5
CD2A1_RAT ENSRNOG00000006664 7,10,11
P53_RAT ENSRNOG00000010756 12,13
IPI00557715.2 ENSRNOG00000024155 14,15,24,25
MYCN_RAT ENSRNOG00000006308 19,3,18

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
4, 5 chr5:142311470-142314658
14, 15, 24, 25 chr16:18713540-18714002
14, 15, 24, 25 chr14:385568-386031
14, 15, 24, 25 chr2:13820109-13820572
7, 10, 11 chr5:108910816-108916237
14, 15, 24, 25 chrX:134147165-134147626
14, 15, 24, 25 chr5:73006274-73006737
14, 15, 24, 25 chr14:12635868-12636325
14, 15, 24, 25 chr3:97329222-97329685
14, 15, 24, 25 chr16:15835507-15835970
0, 1, 16, 17 chr7:98955926-98957577
14, 15, 24, 25 chr2:61256130-61256592
14, 15, 24, 25 chr8:105552588-105553051
2, 3, 18, 19 chr6:36509589-36511969
14, 15, 24, 25 chr5:117080782-117081245
14, 15, 24, 25 chr13:87367068-87367531
14, 15, 24, 25 chr8:44322230-44322693
14, 15, 24, 25 chr20:30707207-30707667
14, 15, 24, 25 chr11:86596120-86596583
14, 15, 24, 25 chr5:11427685-11428146
14, 15, 24, 25 chr9:81396700-81397163
12, 13 chr10:56408801-56409953
14, 15, 24, 25 chr19:19169646-19170109
14, 15, 24, 25 chr16:25751701-25752164
14, 15, 24, 25 chr18:16797030-16797493

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2606961.pdf TCCTGTACCTCGTCCGATTC
1 PMC2606961.pdf ACATGGCACCTCTTGAGGAC
2 PMC2606961.pdf ACCAGCGCTGTGGTCACTA
3 PMC2606961.pdf GTCTTGGGGCGTACAGTGAT
4 PMC2606961.pdf AAGCTTGGGGCAGGAATTAT
5 PMC2606961.pdf GTCTCTTCTCCACCGTCACC
6 PMC2606961.pdf ACCCCAAGTGAGGGTTTTCT
7 PMC2606961.pdf GCACCATAGGAGAGCAGGAG
8 PMC2606961.pdf GTCGCAGGTTCTTGGTCACT
9 PMC2606961.pdf CGAATCTGCACCGTAGTTGA
10 PMC2606961.pdf GAACACTTTCGGTCGTACCC
11 PMC2606961.pdf CCCAGCGGAGGAGAGTAGAT
12 PMC2606961.pdf TTTGAGGTTCGTGTTTGTGC
13 PMC2606961.pdf CCTCATTCAGCTCTCGGAAC
14 PMC2606961.pdf ACCACAGTCCATGCCATCAC
15 PMC2606961.pdf TCCACCACCCTGTTGCTGTA
16 PMC2606961.pdf AAAGGCCCCCAAGGTAGTTA
17 PMC2606961.pdf CTCGCCGTTTCCTCAGTAAG
18 PMC2606961.pdf AGGCAGTCACCACTTTCACC
19 PMC2606961.pdf GTTGTGTTGCTGATGGATGG
20 PMC2606961.pdf ACCCCAAGTGAGGGTTTTCT
21 PMC2606961.pdf GATCCTCTCTGGCCTCAACA
22 PMC2606961.pdf GCTCTGGCTTTCGTGAACAT
23 PMC2606961.pdf TGAGCAGAAGAGCTGCTACG
24 PMC2606961.pdf AAGGGCTCATGACCACAGTC
25 PMC2606961.pdf GGATGCAGGGATGATGTTCT
Display recognized sequences in FASTA format