text2genome

About us

Related Links

Press Coverage

PubMed: 9836492    PubMedCentral: PMC1781830

Vaccinia virus-regulated acute phase cytokine production in human fibroblasts, U937 cells and endothelium.

Rokita H, Kupiec T, Guzik K, Koj A
Mediators of inflammation, 73 , 1998

Abstract:

The production of acute phase cytokines, interleukin 6 (IL-6), tumour necrosis factor (TNFalpha) and interleukin 1 (IL-1beta), was studied in primary cultures of human skin fibroblasts, human monocytic cell line U937 and primary cultures of human umbilical vein endothelial cells (HUVEC) after in vitro infection with vaccinia virus. Significant increase in IL-6 mRNA followed by enhanced protein secretion into the culture media was found in fibroblasts, U937 cells, and HUVEC. TNFalpha increased production in vaccinia virus infected U937 cells resembled closely the pattern of IL-6 production observed in the infected cells. Transient increase in NF-kappaB binding activity was found in the infected U937 (at 90 min) and endothelial (at 30 min) cells. Vaccinia virus induced cytokine production appeared to be transcriptional.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:16193/Il6
EntrezGene:1730/DIAPH2
EntrezGene:17869/Myc
EntrezGene:193740/Hspa1a
EntrezGene:3458/IFNG
EntrezGene:3553/IL1B
EntrezGene:3576/IL8
EntrezGene:3586/IL10
EntrezGene:4609/MYC
EntrezGene:54411/Atp6ap1
EntrezGene:7040/TGFB1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000204490 0,1
TNF ENSG00000206439 0,1
TNF ENSG00000223952 0,1
TNF ENSG00000228321 0,1
TNF ENSG00000228849 0,1
TNF ENSG00000230108 0,1
TNF ENSG00000232810 0,1
IL6 ENSG00000136244 2,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 HSCHR6_MHC_DBB:31525662-31527451
0, 1 HSCHR6_MHC_SSTO:31533461-31535250
0, 1 HSCHR6_MHC_MCF:31619827-31621616
0, 1 HSCHR6_MHC_MANN:31583005-31584794
0, 1 chr6:31543518-31545307
0, 1 HSCHR6_MHC_COX:31530930-31532719
0, 1 HSCHR6_MHC_QBL:31533759-31535550
2, 3 chr7:22769162-22771144

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1781830.pdf ATGAGCACTGAAAGCATGATC
1 PMC1781830.pdf GCAATGATCCCAAAGTAGACCTGCCC
2 PMC1781830.pdf CTTTTGGAGTTTGAGGTATACCTAG
3 PMC1781830.pdf GCTGCGCAGAATGAGATGAGTTGTC
4 PMC1781830.pdf AAGTCCGGGTTTTCCCCAACC
Display recognized sequences in FASTA format