text2genome

About us

Related Links

Press Coverage

PubMed: 19043609    PubMedCentral: PMC2586681

Inhalation with fucose and galactose for treatment of Pseudomonas aeruginosa in cystic fibrosis patients.

Hauber HP, Schulz M, Pforte A, Mack D, Zabel P, Schumacher U
International journal of medical sciences, 371 , 2008

Abstract:

BACKGROUND: Colonisation of cystic fibrosis (CF) lungs with Pseudomonas aeruginosa is facilitated by two lectins, which bind to the sugar coat of the surface lining epithelia and stop the cilia beating. OBJECTIVES: We hypothesized that P. aeruginosa lung infection should be cleared by inhalation of fucose and galactose, which compete for the sugar binding site of the two lectins and thus inhibit the binding of P. aeruginosa. METHODS: 11 adult CF patients with chronic infection with P. aeruginosa were treated twice daily with inhalation of a fucose/galactose solution for 21 days (4 patients only received inhalation, 7 patients received inhalation and intravenous antibiotics). Microbial counts of P. aeruginosa, lung function measurements, and inflammatory markers were determined before and after treatment. RESULTS: The sugar inhalation was well tolerated and no adverse side effects were observed. Inhalation alone as well as combined therapy (inhalation and antibiotics) significantly decreased P. aeruginosa in sputum (P < 0.05). Both therapies also significantly reduced TNFalpha expression in sputum and peripheral blood cells (P < 0.05). No change in lung function measurements was observed. CONCLUSIONS: Inhalation of simple sugars is a safe and effective measure to reduce the P. aeruginosa counts in CF patients. This may provide an alternative therapeutical approach to treat infection with P. aeruginosa.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Homo sapiens
Saccharomyces cerevisiae
Mus musculus
Arabidopsis thaliana
Genes found in fulltext (GNAT)
EntrezGene:10249/GLYAT
EntrezGene:3586/IL10
EntrezGene:3606/IL18
EntrezGene:788/SLC25A20

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
ACTB ENSG00000075624 1,0
TNF ENSG00000204490 2,3
TNF ENSG00000206439 2,3
TNF ENSG00000223952 2,3
TNF ENSG00000228321 2,3
TNF ENSG00000228849 2,3
TNF ENSG00000230108 2,3
TNF ENSG00000232810 2,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
3 HSCHR6_MHC_APD:31556412-31556432
3 HSCHR6_MHC_DBB:31527235-31527255
0, 1 chr7:5568071-5569186
3 HSCHR6_MHC_MANN:31584578-31584598
3 chr6:31545091-31545111
3 HSCHR6_MHC_QBL:31535334-31535354
3 HSCHR6_MHC_MCF:31621400-31621420
3 HSCHR6_MHC_COX:31532503-31532523
3 HSCHR6_MHC_SSTO:31535034-31535054

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2586681.pdf GTGGGGCGCCCCAGGCACCA
1 PMC2586681.pdf CTCCTTAATGTCACGCACGATTTC
2 PMC2586681.pdf CAGAGGGAAGAGTTCCCCAG
3 PMC2586681.pdf CCTTGGTCTGGTAGGAGACG
Display recognized sequences in FASTA format