text2genome

About us

Related Links

Press Coverage

PubMed: 20122174    PubMedCentral: PMC2827467

Axin downregulates TCF-4 transcription via beta-catenin, but not p53, and inhibits the proliferation and invasion of lung cancer cells.

Yang LH, Xu HT, Han Y, Li QC, Liu Y, Zhao Y, Yang ZQ, Dong QZ, Miao Y, Dai SD, Wang EH
Molecular cancer, 25 , 2010

Abstract:

BACKGROUND: We previously reported that overexpression of Axin downregulates T cell factor-4 (TCF-4) transcription. However, the mechanism(s) by which Axin downregulates the transcription and expression of TCF-4 is not clear. It has been reported that beta-catenin promotes and p53 inhibits TCF-4 transcription, respectively. The aim of this study was to investigate whether beta-catenin and/or p53 is required for Axin-mediated downregulation of TCF-4. RESULTS: Axin mutants that lack p53/HIPK2 and/or beta-catenin binding domains were expressed in lung cancer cells, BE1 (mutant p53) and A549 (wild type p53). Expression of Axin or AxinDeltap53 downregulates beta-catenin and TCF-4, and knock-down of beta-catenin upregulates TCF-4 in BE1 cells. However, expression of AxinDeltabeta-ca into BE1 cells did not downregulate TCF-4 expression. These results indicate that Axin downregulates TCF-4 transcription via beta-catenin. Although overexpression of wild-type p53 also downregulates TCF-4 in BE1 cells, cotransfection of p53 and AxinDeltabeta-ca did not downregulate TCF-4 further. These results suggest that Axin does not promote p53-mediated downregulation of TCF-4. Axin, AxinDeltap53, and AxinDeltabeta-ca all downregulated beta-catenin and TCF-4 in A549 cells. Knock-down of p53 upregulated beta-catenin and TCF-4, but cotransfection of AxinDeltabeta-ca and p53 siRNA resulted in downregulation of beta-catenin and TCF-4. These results indicate that p53 is not required for Axin-mediated downregulation of TCF-4. Knock-down or inhibition of GSK-3beta prevented Axin-mediated downregulation of TCF-4. Furthermore, expression of Axin and AxinDeltap53, prevented the proliferative and invasive ability of BE1 and A549, expression of AxinDeltabeta-ca could only prevented the proliferative and invasive ability effectively. CONCLUSIONS: Axin downregulates TCF-4 transcription via beta-catenin and independently of p53. Axin may also inhibits the proliferation and invasion of lung cancer cells via beta-catenin and p53.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:1499/CTNNB1
EntrezGene:6934/TCF7L2
EntrezGene:7157/TP53
EntrezGene:8312/AXIN1

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
AXIN1 ENSG00000103126 0,1
CTNNB1 ENSG00000168036 2,3
TP53 ENSG00000141510 4,5
TCF4 ENSG00000196628 6,7
ACTB ENSG00000075624 8,9

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2 chr3:41275149-41275169
6, 7 chr18:52895465-52899838
8, 9 chr7:5567494-5568001
0 chr16:396569-396592
4, 5 chr17:7572665-7572987

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2827467.pdf ACCGAAAGTACATTCTTGATAAC
1 PMC2827467.pdf TCCATACCTGAACTCTCTGC
2 PMC2827467.pdf GCCAAGTGGGTGGTATAGAG
3 PMC2827467.pdf GCTGGGTATCCTGATGTGC
4 PMC2827467.pdf TCAGTCTACCTCCCGCCATA
5 PMC2827467.pdf TTACATCTCCCAAACATCCCT
6 PMC2827467.pdf CGAGGGTGATGAGAACCTGC
7 PMC2827467.pdf CCCATGTGATTCGATGCGT
8 PMC2827467.pdf AGAGCTACGAGCTGCCTGAC
9 PMC2827467.pdf AGTACTTGCGCTCAGGAGGA
Display recognized sequences in FASTA format