text2genome

About us

Related Links

Press Coverage

PubMed: 18769497    PubMedCentral: PMC2522304

The NALP3/Cryopyrin-inflammasome complex is expressed in LPS-induced ocular inflammation.

González-Benítez JF, Juárez-Verdayes MA, Rodríguez-Martínez S, Cancino-Diaz ME, García-Vázquez F, Cancino-Diaz JC
Mediators of inflammation, , 2008

Abstract:

In the inflammosome complex, NALP3 or NALP1 binds to ASC and activates caspase-1 which induces IL-1beta. In murine LPS-induced ocular inflammation, the production of IL-1beta is increased. We suggest that NALP3- or NALP1-inflammasome complex can be participating in the LPS-induced ocular inflammation. In this work, eye, brain, testis, heart, spleen, and lung were obtained from C3H/HeN mice treated with LPS for 3 to 48 hours, and the expression of NALP1b, NALP3, ASC, caspase-1, IL-1beta, and IL-18 was determined. Infiltrated leukocytes producing IL-1beta in the anterior chamber were found at 12-hour posttreatment. A high upregulated expression of NALP3, ASC, caspase-1, IL-1beta, and IL-18 was found at the same time when infiltrated leukocytes were observed. NALP1b was not detected in the eye of treated mice. NALP3 was also overexpressed in heart and lung. These results suggest that NALP3-, but not NALP1-inflammosome complex, is participating in the murine LPS-induced ocular inflammation.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:216799/Nlrp3
Genes found in fulltext (GNAT)
EntrezGene:114548/NLRP3
EntrezGene:126206/NLRP5
EntrezGene:16173/Il18
EntrezGene:16193/Il6
EntrezGene:1822/ATN1
EntrezGene:195046/Nlrp1a
EntrezGene:216799/Nlrp3
EntrezGene:21898/Tlr4
EntrezGene:22861/AC055839.1
EntrezGene:23968/Nlrp5
EntrezGene:24088/Tlr2
EntrezGene:29108/PYCARD
EntrezGene:3569/IL6
EntrezGene:3606/IL18
EntrezGene:3654/IRAK1
EntrezGene:378425/Nlrp12
EntrezGene:4049/LTA
EntrezGene:4049/LTA
EntrezGene:4049/LTA
EntrezGene:51284/TLR7
EntrezGene:55655/NLRP2
EntrezGene:58484/NLRC4
EntrezGene:637515/Nlrp1b
EntrezGene:66824/Pycard
EntrezGene:7097/TLR2
EntrezGene:7099/TLR4
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:91662/NLRP12

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Actb ENSMUSG00000029580 0,1
Nlrp3 ENSMUSG00000032691 2,3
Nlrp1b ENSMUSG00000070390 4,5
Nlrp5 ENSMUSG00000015721 6,7
Il18 ENSMUSG00000039217 13,14
Il6 ENSMUSG00000025746 15,16
Tnf ENSMUSG00000024401 17,18

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
15, 16 chr5:30340069-30344664
13, 14 chr9:50385899-50389682
17, 18 chr17:35337360-35338069
2, 3 chr11:59369373-59379500
8 chr7:3235248-3235269
12 chr9:5306114-5306133
6 chr7:6072986-6073007
6 chr7:24215182-24215203
0, 1 chr5:143665450-143665924
6 chr7:15171981-15172002
4, 5 chr11:70969720-70975388
11 chr2:96497449-96497468

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2522304.pdf TGGAATCCTGTGGCATCCATGAAAC
1 PMC2522304.pdf TAAAACGCAGCTCAGTAACAGTCCG
2 PMC2522304.pdf CTGTGTGTGGGACTGAAGCAC
3 PMC2522304.pdf GCAGCCCTGCTGTTTCAGCAC
4 PMC2522304.pdf TGGGATGGTTCTAGAAACGCC
5 PMC2522304.pdf AGGGTCCACTGATGTCACTCG
6 PMC2522304.pdf CCTGAGGAATCCAGAATGTGC
7 PMC2522304.pdf GCTTCCACAGGCCAATTATCC
8 PMC2522304.pdf GTACCAACTCCAACCTGATCG
9 PMC2522304.pdf GAAGTAGAGGCCAGATCTTTGC
10 PMC2522304.pdf CTCCCTCATCTTGTCTTGG
11 PMC2522304.pdf TGAAAGAGGTGAAAGAATT
12 PMC2522304.pdf TCTCCAAGACACATTATCT
13 PMC2522304.pdf CTGTACAACCGCAGTAATACGG
14 PMC2522304.pdf ACTCCATCTTGTTGTGTCCTGG
15 PMC2522304.pdf TCTCTGGGAAATCGTGGAAAT
16 PMC2522304.pdf TGTATCTCTCTGAAGGACTCTG
17 PMC2522304.pdf CCTCCCTCTCATCAGTTCTATGG
18 PMC2522304.pdf TGTCCCTTGAAGAGAACCTGG
Display recognized sequences in FASTA format