text2genome

About us

Related Links

Press Coverage

PubMed: 2216740    PubMedCentral: PMC332255

Gene sequence of feline tumor necrosis factor alpha.

McGraw RA, Coffee BW, Otto CM, Drews RT, Rawlings CA
Nucleic acids research, 5563 , 1990

Abstract:

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000204490 0,1
TNF ENSG00000206439 0,1
TNF ENSG00000223952 0,1
TNF ENSG00000228321 0,1
TNF ENSG00000228849 0,1
TNF ENSG00000230108 0,1
TNF ENSG00000232810 0,1

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 HSCHR6_MHC_SSTO:31533461-31535257
0, 1 HSCHR6_MHC_COX:31530930-31532726
0, 1 HSCHR6_MHC_DBB:31525662-31527458
0, 1 HSCHR6_MHC_MCF:31619827-31621623
0, 1 HSCHR6_MHC_MANN:31583005-31584801
0, 1 HSCHR6_MHC_QBL:31533759-31535557
0, 1 chr6:31543518-31545314

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC332255.txt ATGAGCACTGAAAGCATGATC
1 PMC332255.txt TCACAGGGCAATGATCCCAAAGTA
2 PMC332255.txt GAGCTGGCCGAGGAGGCACTCCCCAAGAAGGCAGGGGGCCCCCAGGGCTCCGGAAGGTGCTTGTGCCTCA
3 PMC332255.txt GCCTCTTCTCCTTCCTCCTCGTCGCAGGAGCCACCACACTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGGGAAGAGGTGAGTGCCACACCAGACTTGGCTCATTCTCCTACCCAGAGAGAAATGGGAGGGCAGGAGGGCAAGAAATGGGGTGGGGGAAGGAGGTGTGCTGATGGGGATGGGTGAGAGAGAAAACGTGGAGAAAGACGGGAGGCAGAAAGAGATGTGGAGAGCGATGAAGAGAGAAGGGACGGAGCACACCAAAGGGTCTCTCTAAGCACTTCTTGAATGAATGAATGAGCACACACATAGACAGACAGACAGAGAGACAGAGAGAGAGAGAGAGATGTGTGGAGAGATGTGGGGTGTGGGTTGAGAGATGGGAATAAAGATGCGAGACACAATGATGTGGGCGATATGAGAGAGATAAGGAAAGAGGTGAAGAAAGAGATAAGGAAAGACAGACAGATGTCTGTCACGAGGAAGACAGTGAAAGTGCTGTTGAATGAATGAATGGATGAATCAATCGATGAACGGAGAGAGAGAACCAGAGTATGAGCTGCATAAACAACCTAGCTGTTTCTCGGTTAGGGGTAACTTGTTCTGATGCTAAACCTCCTCCTTCTCCCCAACAG
4 PMC332255.txt CTCCCACATGGCCTGCAACTAATCAACCCTCTGCCCCAGACACTCAGTAAGTGTCTCCAAAGCTTCTCTCCTGGTTCTGGGCTTGGGCGAGGGTGGAGGTTAGTCCTGGGATAGCAGCAGAGGGGGAAATTCAGAGTTTGGGTTTGAGGGGAGGAGGAATGGAAGTCAAAGTGGGATATTTTCCAGGAAGCGTAAGGGTCTCACCTTTTTCTTTCCTCTTTCCTCCTCAG
5 PMC332255.txt GATCATCTTCTCGAACTCCGAGTGACA
6 PMC332255.txt AGCCAGTAGCCCATGTAGTAGGTAAGACTTCTGAGGCTGTAGCAGGAGGATGGCGAAAGGGTGGGACATAGAGGGCTAGGATTTGGGGGCTGAGCAGGCTGAAGGCTGAGCCCAGGCCTTGGAGATGATATGAGAAGGACTCACTGAGCTCAAGGAGAGAGTGAAGGAAGAGCACAGGCCTTGAGGGGGACACTCAGAACCTCATGGCCACATGAGACGTGGGAGGACAGACAGAGGGGACAGGAACCGGATGTGGGGGGGGGGGGCAGAACTTGAGGGCCAGGATGTGGAGAGTGGAACTAACAGGGTCACACTGACTTACCCCTCCCTCCTTCTCTCCTTCCCTCCAG
7 PMC332255.txt CAAACCCCGAAGCTGAAGGGCAACTCCAGCGGCTGAGCCGGCGTGCCAATA
8 PMC332255.txt GCCCTCCTGGCCAATGGCGTGGAGCTGACAGACAACCAACTGAAGGTGCCCTCAGACGGGCTGTACCTCATCTACTCCCAGGTCCTCTTCACGGGCCAAGC
9 PMC332255.txt GATGTCCTTCCACACATGTGCTCCTCACCCACGCCATCAGCCGCTTTGCCGTTTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCTTG
10 PMC332255.txt CCAGAGGGAGACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTACCTGGGAGGGGTCTTCCAACTGGAGAAGGGTGATCGACTCAGCACT
11 PMC332255.txt GAGATCAATCTGCCTGCCTATCTTGACTTTGCCGAGTCTG
Display recognized sequences in FASTA format