text2genome

About us

Related Links

Press Coverage

PubMed: 19798426    PubMedCentral: PMC2745574

RNase L mediated protection from virus induced demyelination.

Ireland DD, Stohlman SA, Hinton DR, Kapil P, Silverman RH, Atkinson RA, Bergmann CC
PLoS pathogens, , 2009

Abstract:

IFN-alpha/beta plays a critical role in limiting viral spread, restricting viral tropism and protecting mice from neurotropic coronavirus infection. However, the IFN-alpha/beta dependent mechanisms underlying innate anti-viral functions within the CNS are poorly understood. The role of RNase L in viral encephalomyelitis was explored based on its functions in inhibiting translation, inducing apoptosis, and propagating the IFN-alpha/beta pathway through RNA degradation intermediates. Infection of RNase L deficient (RL(-/-)) mice with a sub-lethal, demyelinating mouse hepatitis virus variant revealed that the majority of mice succumbed to infection by day 12 p.i. However, RNase L deficiency did not affect overall control of infectious virus, or diminish IFN-alpha/beta expression in the CNS. Furthermore, increased morbidity and mortality could not be attributed to altered proinflammatory signals or composition of cells infiltrating the CNS. The unique phenotype of infected RL(-/-) mice was rather manifested in earlier onset and increased severity of demyelination and axonal damage in brain stem and spinal cord without evidence for enhanced neuronal infection. Increased tissue damage coincided with sustained brain stem infection, foci of microglia infection in grey matter, and increased apoptotic cells. These data demonstrate a novel protective role for RNase L in viral induced CNS encephalomyelitis, which is not reflected in overall viral control or propagation of IFN-alpha/beta mediated signals. Protective function is rather associated with cell type specific and regional restriction of viral replication in grey matter and ameliorated neurodegeneration and demyelination.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:24014/Rnasel
Genes found in fulltext (GNAT)
EntrezGene:14131/Fcgr3
EntrezGene:14433/380687-208
EntrezGene:14580/Gfap
EntrezGene:15957/Ifit1
EntrezGene:15958/Ifit2
EntrezGene:16409/Itgam
EntrezGene:17880/Myh11
EntrezGene:18040/Nefm
EntrezGene:19264/Ptprc
EntrezGene:24387/GFAP_RAT
EntrezGene:246728/Oas2
EntrezGene:54123/Irf7

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Ifit1 ENSMUSG00000034459 0,1
Ifit2 ENSMUSG00000045932 2,3
Oas2 ENSMUSG00000032690 4,5
Tnf ENSMUSG00000024401 7,8
Gapdh ENSMUSG00000057666 9,10

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
9, 10 chr3:121933324-121933431
9, 10 chr1:15259091-15259198
9, 10 chr6:83824584-83824691
9, 10 chr4:57384036-57384143
9, 10 chr2:104132413-104132520
9, 10 chr9:51431540-51431647
9, 10 chr14:49028983-49029090
9, 10 chr15:43048912-43049014
9, 10 chr19:40287550-40287657
9, 10 chr1:182257513-182257620
9, 10 chrX:77439401-77439508
4, 5 chr5:121188562-121188729
9, 10 chr6:91379559-91379666
9, 10 NT_166349:397104-397211
9, 10 chr13:17913468-17913575
9, 10 chr11:20235226-20235333
9, 10 chr14:12113657-12113764
9, 10 chr10:22511773-22511868
9, 10 chr8:77929628-77929735
9, 10 chr11:63126023-63126130
7, 8 chr17:35338038-35338656
9, 10 chr18:56132626-56132733
9, 10 chr6:125112371-125112562
9, 10 chr9:75541671-75541778
9, 10 chr2:11330868-11330975
9, 10 chr9:51810590-51810697
9, 10 chr2:43374128-43374235
9, 10 chr12:5596634-5596741
0 chr7:149867960-149868009
9, 10 chr17:14846743-14846850
9, 10 chr5:96291415-96291522
9, 10 chr13:49900524-49900631
9, 10 chr3:142626257-142626364
9, 10 chr15:93027710-93027817
9, 10 chr16:19723752-19723859
9, 10 chr8:94212479-94212586
9, 10 chr7:59002749-59002856
9, 10 chr4:91518570-91518677
9, 10 chr3:52417439-52417546
1 chr19:34722010-34722031
9, 10 chr7:107909530-107909637
9, 10 chr8:47340236-47340343
9, 10 chr10:33528511-33528618
9, 10 chr5:13042644-13042751
9, 10 chr4:82840579-82840686
9, 10 chr11:26687315-26687422
9, 10 chr15:4835802-4835909
9, 10 chr7:96756887-96756994
9, 10 chr1:12556148-12556255
9, 10 chr9:45644223-45644330
9, 10 chr6:22654097-22654204
9, 10 chr8:60029781-60029888
9, 10 chr3:139313025-139313132
9, 10 chr5:34824455-34824562
9, 10 chr18:54144663-54144770
2 chr19:34644778-34644798
9, 10 chr19:25870511-25870618
9, 10 chr12:71021670-71021777
9, 10 chr2:28789339-28789446
9, 10 chr14:103769893-103770000
9, 10 chr15:12505326-12505433
9, 10 chr8:95240037-95240144
9, 10 chr5:106291931-106292038
9, 10 chrX:12903357-12903464
9, 10 chr2:161080397-161080504
9, 10 chr13:99172260-99172367
9, 10 chrX:148380591-148380698

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2745574.pdf CCTTTACAGCAACCATGGGAGA
1 PMC2745574.pdf GCAGCTTCCATGTGAAGTGAC
2 PMC2745574.pdf AGAGGAAGAGGTTGCCTGGA
3 PMC2745574.pdf CTCGTTGTACTCATGACTGCTG
4 PMC2745574.pdf AAAAATGTCTGCTTCTTGAATTCTGA
5 PMC2745574.pdf TGTGCCTTTGGCAGTGGAT
6 PMC2745574.pdf ATTGGGTTGAGTAGTTGCAG
7 PMC2745574.pdf GCCACCACGCTCTTCTGTCT
8 PMC2745574.pdf GGTCTGGGCCATAGAACTGATG
9 PMC2745574.pdf CATGGCCTTCCGTGTTCCTA
10 PMC2745574.pdf ATGCCTGCTTCACCACCTTCT
Display recognized sequences in FASTA format