text2genome

About us

Related Links

Press Coverage

PubMed: 19551144    PubMedCentral: PMC2696084

Modulation of the intestinal microbiota alters colitis-associated colorectal cancer susceptibility.

Uronis JM, Mühlbauer M, Herfarth HH, Rubinas TC, Jones GS, Jobin C
PloS one, , 2009

Abstract:

It is well established that the intestinal microbiota plays a key role in the pathogenesis of Crohn's disease (CD) and ulcerative colitis (UC) collectively referred to as inflammatory bowel disease (IBD). Epidemiological studies have provided strong evidence that IBD patients bear increased risk for the development of colorectal cancer (CRC). However, the impact of the microbiota on the development of colitis-associated cancer (CAC) remains largely unknown. In this study, we established a new model of CAC using azoxymethane (AOM)-exposed, conventionalized-Il10(-/-) mice and have explored the contribution of the host intestinal microbiota and MyD88 signaling to the development of CAC. We show that 8/13 (62%) of AOM-Il10(-/-) mice developed colon tumors compared to only 3/15 (20%) of AOM- wild-type (WT) mice. Conventionalized AOM-Il10(-/-) mice developed spontaneous colitis and colorectal carcinomas while AOM-WT mice were colitis-free and developed only rare adenomas. Importantly, tumor multiplicity directly correlated with the presence of colitis. Il10(-/-) mice mono-associated with the mildly colitogenic bacterium Bacteroides vulgatus displayed significantly reduced colitis and colorectal tumor multiplicity compared to Il10(-/-) mice. Germ-free AOM-treated Il10(-/-) mice showed normal colon histology and were devoid of tumors. Il10(-/-); Myd88(-/-) mice treated with AOM displayed reduced expression of Il12p40 and Tnfalpha mRNA and showed no signs of tumor development. We present the first direct demonstration that manipulation of the intestinal microbiota alters the development of CAC. The TLR/MyD88 pathway is essential for microbiota-induced development of CAC. Unlike findings obtained using the AOM/DSS model, we demonstrate that the severity of chronic colitis directly correlates to colorectal tumor development and that bacterial-induced inflammation drives progression from adenoma to invasive carcinoma.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:12387/Ctnnb1
EntrezGene:16160/Il12b
EntrezGene:16193/Il6
EntrezGene:20848/Stat3
EntrezGene:3606/IL18
EntrezGene:3815/KIT
EntrezGene:4615/MYD88
EntrezGene:5966/REL
EntrezGene:5970/RELA
EntrezGene:6774/STAT3
EntrezGene:7099/TLR4

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1
Il12b ENSMUSG00000004296 2,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr17:35337815-35338785
2, 3 chr11:44223794-44226066

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2696084.pdf ATGAGCACAGAAAGCATGATC
1 PMC2696084.pdf TACAGGCTTGTCACTCGAATT
2 PMC2696084.pdf CACGGCAGCAGAATAAATATG
3 PMC2696084.pdf TTGCATTGGACTTCGGTAGA
Display recognized sequences in FASTA format