text2genome

About us

Related Links

Press Coverage

PubMed: 19907652    PubMedCentral: PMC2771351

Evidence for impaired CARD15 signalling in Crohn's disease without disease linked variants.

Seidelin JB, Broom OJ, Olsen J, Nielsen OH
PloS one, , 2009

Abstract:

BACKGROUND: Sensing of muramyl dipeptide (MDP) is impaired in Crohn's disease (CD) patients with disease-linked variants of the CARD15 (caspase activation and recruitment domain 15) gene. Animal studies suggest that normal CARD15 signalling prevents inflammatory bowel disease, and may be important for disease development in CD. However, only a small fraction of CD patients carry the disease linked CARD15 variants. The aim of this study was thus to investigate if changes could be found in CARD15 signalling in patients without disease associated CARD15 variants. METHODOLOGY/PRINCIPAL FINDINGS: By mapping the response to MDP in peripheral monocytes obtained from CD patients in remission not receiving immunosuppresives, an impaired response to MDP was found in patients without disease linked CARD15 variants compared to control monocytes. This impairment was accompanied by a decreased activation of IkappaB kinase alpha/beta (IKKalpha/beta), the initial step in the nuclear factor kappaB (NFkappaB) pathway, whereas activation of mitogen-activated protein (MAP)-kinases was unaffected. MDP additionally stimulates the inflammasome which is of importance for processing of cytokines. The inflammasome was constitutively activated in CD, but unresponsive to MDP both in CD and control monocytes. CONCLUSIONS/SIGNIFICANCE: These results suggest that inhibited MDP-dependent pathways in CD patients not carrying the disease-associated CARD15 variants might be of importance for the pathogenesis of CD. The results reveal a dysfunctional immune response in CD patients, not able to sense relevant stimuli on the one hand, and on the other hand possessing constitutively active cytokine processing.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:64127/NOD2
Genes found in fulltext (GNAT)
EntrezGene:114548/NLRP3
EntrezGene:257632/Nod2
EntrezGene:29108/PYCARD
EntrezGene:5599/MAPK8
EntrezGene:64127/NOD2
EntrezGene:7099/TLR4
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:841/CASP8
EntrezGene:8767/RIPK2

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
IL1B ENSG00000125538 0,1
TNF ENSG00000204490 2,3
TNF ENSG00000206439 2,3
TNF ENSG00000223952 2,3
TNF ENSG00000228321 2,3
TNF ENSG00000228849 2,3
TNF ENSG00000230108 2,3
TNF ENSG00000232810 2,3
CASP1 ENSG00000137752 4,5
NLRP3 ENSG00000162711 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3 HSCHR6_MHC_DBB:31525662-31526485
0, 1 chr2:113591089-113593788
2, 3 HSCHR6_MHC_QBL:31533759-31534584
2, 3 HSCHR6_MHC_MANN:31583005-31583828
2, 3 chr6:31543518-31544341
7 chr1:247592976-247592996
2, 3 HSCHR6_MHC_COX:31530930-31531753
2, 3 HSCHR6_MHC_MCF:31619827-31620650
2, 3 HSCHR6_MHC_SSTO:31533461-31534284
4, 5 chr11:104901178-104912436

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2771351.pdf CTCGCCAGTGAAATGATGGCT
1 PMC2771351.pdf GTCGGAGATTCGTAGCTGGAT
2 PMC2771351.pdf ATGAGCACTGAAAGCATGATCC
3 PMC2771351.pdf GAGGGCTGATTAGAGAGAGGTC
4 PMC2771351.pdf AGTGCAGGACAACCCAGCTA
5 PMC2771351.pdf AGATAATGAGAGCAAGACGTGTG
6 PMC2771351.pdf TCTCATGGATTGGTGAACAGC
7 PMC2771351.pdf GGTCCCCCAGAGAATTGTCA
Display recognized sequences in FASTA format