text2genome

About us

Related Links

Press Coverage

PubMed: 19381346    PubMedCentral: PMC2669445

Molecular evidence of senescence in corneal endothelial cells of senescence-accelerated mice.

Xiao X, Wang Y, Gong H, Chen P, Xie L
Molecular vision, 747 , 2009

Abstract:

PURPOSE: To investigate senescent evidence in corneal endothelial cells (CECs) of the senescence-accelerated mouse (SAM), which is considered a suitable animal model for the further study of the senescent mechanism in CECs. METHODS: Thirty-six male mice from a senescence resistant mouse strain (SAM R1) and a senescence-prone strain (SAM P8) at various ages (1, 6, and 12 months) were analyzed in this study. The endothelial cell density (ECD) and cell viability were detected using trypan blue and alizarin red dyes while the senescent cells were observed by senescence-associated beta-galactosidase (SA-beta-Gal; pH 6.0) staining. In addition, ultrastructure was observed using an electron microscope. The senescence-related genes (p16(INK4a), p19(ARF), p21(WAF1/CIP1), and p53) in the CECs were visualized via immunohistochemistry and were quantitatively detected using real-time polymerase chain reaction (PCR). Signal proteins of phospho-extracellular signal-regulated kinase 1/2 (p-ERK 1/2) were detected by western blot analysis. RESULTS: Our results indicated that the ECD values decreased with increasing age in both the SAM-R1 and SAM P8 series where the values in the older SAM p8 series decreased even lower than in the older SAM R1 series. The mean decreased rate was 2.276% per month in the SAM R1 and 2.755% per month in the SAM P8 series. In addition, changes in the senescence-like ultrastructure were observed in the CECs of both strains, and the increase in the positive staining of SA-beta-Gal was observed in both strains as well. It is worth noting that such changes were more significant in the SAM P8 strain. Immunohistochemical detection assays indicated the expression of p-ERK 1/2, p16(INK4a), p19(ARF), p21(WAF1/CIP1), and p53 (nuclear localization for each) in each age group analyzed. Furthermore, the results of real-time PCR studies showed an increase in the expression of p16(INK4a) mRNA as a function of age in the SAM R1 strain and in the early senescence stage of the SAM P8 strain in addition to an increase in the expression of p21(WAF1/CIP1) and p53 mRNA as a function of age in the SAM P8 strain (no significant increase was observed in the SAM R1 strain). Additional results from western blot analysis demonstrated an age-related increase in the quantity of the p-ERK 1/2 proteins in both strains. CONCLUSIONS: The SAM R1 and SAM P8 strains represent suitable models for the study of CEC senescence in vivo. In addition, the progression of cellular senescence in CECs occurs more quickly in the SAM P8 strain as opposed to the SAM R1 strain. Our results also indicate that the p16(INK4a) signaling pathway may play a key role in the early stages of senescence in CECs while the p53/p21(WAF1/CIP1) signaling pathway may exert its principle effect in the late stages of senescence in CECs. Further study is still required about the role of the mitogen-activated protein kinase (MAPK) signaling cascade in the process of senescence in CECs.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1026/CDKN1A
EntrezGene:1027/CDKN1B
EntrezGene:1029/CDKN2A
EntrezGene:12236/Bub1b
EntrezGene:12578/Cdkn2a
EntrezGene:13666/Eif2ak3
EntrezGene:22059/Trp53
EntrezGene:2597/GAPDH
EntrezGene:3815/KIT
EntrezGene:5595/MAPK3
EntrezGene:57162/PELI1
EntrezGene:7157/TP53
EntrezGene:7462/LAT2
EntrezGene:973/CD79A

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Cdkn2a ENSMUSG00000044303 0,1
Trp53 ENSMUSG00000059552 2,3,5,6
Gapdh ENSMUSG00000057666 7,8

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
7, 8 chr6:83824542-83824776
7, 8 chr2:104132328-104132562
7, 8 chr12:82473369-82473604
7, 8 chr8:95239995-95240229
7, 8 chr7:59002664-59002898
7, 8 NT_166349:397019-397253
7, 8 chr11:63125981-63126215
7, 8 chr11:4464234-4464455
7, 8 chr2:146580603-146580837
7, 8 chr3:142626172-142626406
7, 8 chr4:82840494-82840728
7, 8 chr15:4835717-4835951
7, 8 chr15:12505241-12505475
7, 8 chr7:96756802-96757036
7, 8 chr5:13042602-13042836
7, 8 chr10:33528469-33528703
7, 8 chr17:14846658-14846892
7, 8 chr9:51431455-51431689
7, 8 chr15:10490432-10490665
7, 8 chr3:121933282-121933516
7, 8 chr13:94064302-94064536
0 chr4:88922801-88922822
7, 8 chr2:151200379-151200613
7, 8 chr15:93027625-93027859
7, 8 chr14:103769851-103770085
7, 8 chr2:28789297-28789531
7, 8 chr13:49900482-49900716
2, 3, 5, 6 chr11:69400906-69403125
7, 8 chr11:20235184-20235418
7, 8 chr11:3852328-3852549
7, 8 chr7:107909488-107909722
7, 8 chr5:106291889-106292123
7, 8 chr3:46888818-46889052
7, 8 chr13:99172218-99172452
7, 8 chr2:11330826-11331060
7, 8 chr11:26687230-26687464
7, 8 chr13:98228273-98228507
7, 8 chrX:117274922-117275156
7, 8 chr6:91379474-91379708
7, 8 chr19:25870469-25870703
7, 8 chr6:125112329-125112647
7, 8 chr3:78721777-78722011
7, 8 chr15:84697341-84697575
7, 8 chr8:60029696-60029930
7, 8 chr4:83751402-83751636
7, 8 chr4:91518528-91518762
7, 8 chr8:77929586-77929820
4 chr17:29235635-29235654
7, 8 chr18:54144578-54144812
7, 8 chr3:52417354-52417588
7, 8 chr1:188784989-188785222
7, 8 chrX:77439359-77439593
7, 8 chr12:71021628-71021862
7, 8 chr5:96291330-96291564
7, 8 chr1:15259049-15259283
7, 8 chr3:139312940-139313174
7, 8 chr4:57383994-57384228
7, 8 chr8:42694191-42694419

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2669445.pdf AGGACCCCACTACCTTCTCCC
1 PMC2669445.pdf AAATATCGCACGATGTCTTGATG
2 PMC2669445.pdf GGCATGAACCGCCGACCTAT
3 PMC2669445.pdf GGGCAGGCACAAACACGAAC
4 PMC2669445.pdf TGCAGCAGGGCAGAGGAAG
5 PMC2669445.pdf CCCCAGGATGTTGAGGAGTTT
6 PMC2669445.pdf TTGAGAAGGGACAAAAGATGACA
7 PMC2669445.pdf CTGCCCAGAACATCATCCCT
8 PMC2669445.pdf GGTCCTCAGTGTAGCCCAAGA
Display recognized sequences in FASTA format