text2genome

About us

Related Links

Press Coverage

PubMed: 1975679    PubMedCentral: PMC332032

AccII polymorphism of the p53 gene.

de la Calle-Martín O, Fabregat V, Romero M, Soler J, Vives J, Yagüe J
Nucleic acids research, 4963 , 1990

Abstract:

Images

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:126014/OSCAR
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,1

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr17:7579311-7579570

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC332032.txt AATGGATGATTTGATGCTGTCCC
1 PMC332032.txt CGTGCAAGTCACAGACTTGGC
Display recognized sequences in FASTA format