text2genome

About us

Related Links

Press Coverage

PubMed: 19709398    PubMedCentral: PMC2754429

delta-Opioid receptor activation attenuates oxidative injury in the ischemic rat brain.

Yang Y, Xia X, Zhang Y, Wang Q, Li L, Luo G, Xia Y
BMC biology, 55 , 2009

Abstract:

BACKGROUND: We have recently shown that delta-opioid receptors (DORs) play an important role in neuroprotection from hypoxic injury via the regulation of extracellular signaling-regulated kinase (ERK) and cytochrome c release. Since ERK and cytochrome c are differentially involved in caspase signaling of oxidative injury that significantly contributes to neuronal damage in ischemia/reperfusion, we considered if DOR activation protects the ischemic brain by attenuating oxidative injury. RESULTS: We observed that, in a model of cerebral ischemia with middle cerebral artery occlusion, DOR activation increased the activity of major antioxidant enzymes, glutathione peroxidase and superoxide dismutase, and decreased malondialdehyde and nitric oxide levels in the cortex exposed to cerebral ischemia/reperfusion. In addition, DOR activation reduced caspase 3 expression, though it did not significantly affect the increase in interleukin (IL)1beta and tumor necrosis factor (TNF)alpha expression at the same timepoint. PD98059, an inhibitor of mitogen-activated protein kinase (MAPK) extracellular signaling-regulated kinase kinase, accelerated animal death during ischemia/reperfusion. CONCLUSION: DOR activation attenuates oxidative injury in the brain exposed to ischemia/reperfusion by enhancing antioxidant ability and inhibiting caspase activity, which provides novel insights into the mechanism of DOR neuroprotection.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:24613/OPRD_RAT
Genes found in fulltext (GNAT)
EntrezGene:24338/EPHB1_RAT

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNFA_RAT ENSRNOG00000000837 3,4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2 chr3:116965022-116965043
3, 4, 5 chr20:3662793-3662917

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2754429.pdf caagaaggaaggctggaaaaga
1 PMC2754429.pdf caacgagcggttccgatgccct
2 PMC2754429.pdf aagcggtttgtcttcaacaag
3 PMC2754429.pdf gtgttcatccgttctctaccc
4 PMC2754429.pdf gccacaattccctttctaagtt
5 PMC2754429.pdf acccctttatcgtctactcctcagagccc
Display recognized sequences in FASTA format