text2genome

About us

Related Links

Press Coverage

PubMed: 18355415    PubMedCentral: PMC2330034

Neuronal apoptosis and inflammatory responses in the central nervous system of a rabbit treated with Shiga toxin-2.

Takahashi K, Funata N, Ikuta F, Sato S
Journal of neuroinflammation, 11 , 2008

Abstract:

BACKGROUND: Shiga toxins (Stxs) are the major agents responsible for hemorrhagic colitis and hemolytic-uremic syndrome (HUS) during infections caused by Stx-producing Escherichia coli (STEC) such as serotype O157:H7. Central nervous system (CNS) involvement is an important determinant of mortality in diarrhea associated-HUS. It has been suggested that vascular endothelial injuries caused by Stxs play a crucial role in the development of the disease. The current study investigates the relationship between the cytotoxic effects of Stxs and inflammatory responses in a rabbit brain treated with Stx2. METHODS: In a rabbit model treated with purified Stx2 or PBS(-), we examined the expression of the Stx receptor globotriaosylceramide (Gb3)/CD77 in the CNS and microglial activation using immunohistochemistry. The relationship between inflammatory responses and neuronal cell death was analyzed by the following methods: real time quantitative reverse transcriptase (RT)-polymerase chain reaction (PCR) to determine the expression levels of pro-inflammatory cytokines, and the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick-end labeling (TUNEL) method to detect apoptotic changes. RESULTS: Gb3/CD77 expression was detected in endothelial cells but not in neurons or glial cells. In the spinal cord gray matter, significant levels of Gb3/CD77 expression were observed. Severe endothelial injury and microvascular thrombosis resulted in extensive necrotic infarction, which led to acute neuronal damage. Conversely, in the brain, Stx receptor expression was much lower. The observed neuropathology was less severe. However, neuronal apoptosis was observed at the onset of neurological symptoms, and the number of apoptotic cells significantly increased in the brain at a later stage, several days after onset. Microglial activation was observed, and tumor necrosis factor (TNF)-alpha and interleukin (IL)-1beta mRNA in the CNS parenchyma was significantly up-regulated. There was significant overexpression of TNF-alpha transcripts in the brain. CONCLUSION: This study indicates that Stx2 may not directly damage neural cells, but rather inflammatory responses occur in the brain parenchyma in response to primary injury by Stx2 in vascular endothelial cells expressing Gb3/CD77. These findings suggest that neuroinflammation may play a critical role in neurodegenerative processes during STEC infection and that anti-inflammatory intervention may have therapeutic potential.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Oryctolagus cuniculus
Escherichia coli
Homo sapiens
Mus musculus
Escherichia coli O157:H7
Rattus norvegicus
Capra hircus
Ricinus communis
Armoracia rusticana
Griffonia simplicifolia
Papio hamadryas
Measles virus
Molva molva
Fraxinus berlandieriana
Japanese encephalitis virus
Human immunodeficiency virus
Human immunodeficiency virus 1
Lateolabrax japonicus
Genes found in fulltext (GNAT)
EntrezGene:15898/Icam5
EntrezGene:1791/DNTT
EntrezGene:2054/STX2
EntrezGene:21926/Tnf
EntrezGene:2597/GAPDH
EntrezGene:3815/KIT
EntrezGene:5476/CTSA
EntrezGene:581/BAX
EntrezGene:596/BCL2
EntrezGene:6804/STX1A
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7462/LAT2

Best predicted genome from sequences: Oryctolagus cuniculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNFA_RABIT ENSOCUG00000006698 0,1

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1 GeneScaffold_6795:38808-38828
4, 5 scaffold_212581:41005-41313

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2330034.pdf AGCCCACGTAGTAGCAAACCC
1 PMC2330034.pdf GAGAGGAGGTTGACCTTGTT
2 PMC2330034.pdf GAATCTGAACCAACAAGTGG
3 PMC2330034.pdf ATGTACCAGTTGGGGAACT
4 PMC2330034.pdf TCTCTCAAGATTGTCAGCAA
5 PMC2330034.pdf AGGTCCACGACCGACACGTT
Display recognized sequences in FASTA format