text2genome

About us

Related Links

Press Coverage

PubMed: 19421412    PubMedCentral: PMC2676200

Proinflammatory cytokines in a mouse model of central retinal artery occlusion.

Kramer M, Dadon S, Hasanreisoglu M, Monselise Y, Avraham BR, Feldman A, Eldar I, Weinberger D, Goldenberg-Cohen N
Molecular vision, 885 , 2009

Abstract:

PURPOSE: To analyze cytokines in the retina and serum in an experimental model of central retinal artery occlusion (CRAO) in mice. METHODS: CRAO was induced by laser activation of intravenously injected rose bengal, a photosensitive dye, in 60 C57Bl/6 mice. mRNA and protein levels of macrophage inhibitory protein-2 (MIP-2), interleukin-6 (IL-6), and tumor necrosis factor- alpha (TNF-alpha) were analyzed using real-time polymerase chain reaction, and western blot, respectively. Cytokine levels in serum were measured by ELISA. Analysis was performed at various time intervals from CRAO induction. RESULTS: In the retina, MIP-2 and IL-6 mRNA expression decreased 3 h after induction of CRAO and increased thereafter, peaking at 12-24 h. By 7 days, levels were again mostly undetectable. TNF-alpha mRNA expression increased at 3 h and decreased to control levels at 7 days. At the protein level, all cytokines were present at 3 h, following similar patterns to their respective gene expression thereafter. In serum, MIP-2 and TNF-alpha levels peaked early, and decreased to control levels at 12 h, with a second late rise of TNF-alpha. IL-6 levels increased between 3 and 12 h and decreased at 24 h. CONCLUSIONS: Temporal variations in cytokines were observed following the induction of CRAO, both at the retinal mRNA expression and protein levels. These temporal changes, and the variable effects of the cytokines at the different time intervals, should be taken into account during the formulation of therapeutic strategies.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:114105/CXCL2_RAT
EntrezGene:11461/Actb
EntrezGene:16193/Il6
EntrezGene:20310/Cxcl2
EntrezGene:21926/Tnf
EntrezGene:3569/IL6
EntrezGene:57162/PELI1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr17:35337478-35337842
0, 1 chr5:30340067-30341422

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2676200.pdf TCTCAAAATTCGAGTGACAAGCGTTCTCTGGGAAATCGTGGAGCGCCCAGACAGAAGTCATAG
1 PMC2676200.pdf ACTCCAGCTGCTCCTCCACTTCTGCAAGTGCATCATCGTGGCAAACTTTTTGACCGCC
Display recognized sequences in FASTA format