text2genome

About us

Related Links

Press Coverage

PubMed: 19646232    PubMedCentral: PMC2727495

In vitro, but not in vivo, reversibility of peritoneal macrophages activation during experimental acute pancreatitis.

Gea-SorlĂ­ S, Closa D
BMC immunology, 42 , 2009

Abstract:

BACKGROUND: Systemic inflammatory response syndrome is one of the major pathobiologic processes underlying severe acute pancreatitis and the degree of macrophage activation could be one of the factors that finally determine the severity of the disease. We evaluated the activation phenotype in peritoneal macrophages during the progression of an experimental model of acute pancreatitis induced in rats by intraductal administration of 5% sodium taurocholate and the effect of IL-4 and IL-13 to modulate this activation. Samples of pancreas, lung and adipose tissue as well as plasma were also obtained. In some animals IL4 and IL13 were injected 1 h after induction in order to modulate macrophage activation. The expressions of TNFalpha and Mannose Receptor, as indicators of classical and alternative macrophage activation, were evaluated. Levels of myeloperoxidase and plasma lipase were determined to evaluate the severity of the inflammatory process. The stability of IL-4 in ascitic fluid and plasma was evaluated. RESULTS: Peritoneal macrophages showed a classical M1 activation clearly induced 3 h after pancreatitis induction and maintained until 18 h. Treatment with IL-4 and IL-13 reversed the activation of macrophages from a classical M1 to alternative M2 in vitro, but failed to modulate the response of peritoneal macrophages in vivo despite a reduction in inflammation was observed in lung and adipose tissue. Finally, IL-4 shows a short half-live in ascitic fluid when compared with plasma. CONCLUSION: Peritoneal macrophages adopt a pro-inflammatory activation early during acute pancreatitis. Treatment with M2 cytokines could revert in vitro the pancreatitis-induced activation of macrophages but fails to modulate its activation in vivo. This treatment has only a moderate effect in reducing the systemic inflammation associated to acute pancreatitis. Hydrolytic enzymes presents in ascitic fluid could be involved in the degradation of cytokines, strongly reducing its utility to modulate peritoneal macrophages in pancreatitis.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:24383/G3P_RAT

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNFA_RAT ENSRNOG00000000837 0,1
NP_001099593.1 ENSRNOG00000018251 2,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr20:3661052-3661264
4, 5 chr7:138465690-138472983
2, 3 chr17:88458945-88459056

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2727495.pdf AACTCCCAGAAAAGCAAGCA
1 PMC2727495.pdf CGAGCAGGAATGAGAAGAGG
2 PMC2727495.pdf GCAGGTGGTTTATGGGATGT
3 PMC2727495.pdf GGGTTCAGGAGTTGTTGTGG
4 PMC2727495.pdf CTGTGTCTTTCCGCTGTTTTC
5 PMC2727495.pdf TGTGCTGTGCTTATGGTCTCA
Display recognized sequences in FASTA format