text2genome

About us

Related Links

Press Coverage

PubMed: 20084294    PubMedCentral: PMC2805707

p300 alters keratinocyte cell growth and differentiation through regulation of p21(Waf1/CIP1).

Wong PP, Pickard A, McCance DJ
PloS one, , 2010

Abstract:

BACKGROUND: p300 functions as a transcriptional co-activator to regulate many cellular responses such as cell growth, transformation, development and differentiation. It has been shown to affect the transcriptional activity of p53 which regulates p21(Waf1/CIP1) expression, however, the role of p300 in differentiation remains unclear. METHODOLOGY AND PRINCIPAL FINDINGS: Knockdown of p300 protein with short hairpin RNA (shRNA) molecules delays human neonatal foreskin keratinocyte (HFKs) differentiation. Moreover, depletion of p300 increases the proliferative capacity of HFKs, extends the life span of cells and allows differentiated HFKs to re-enter the cell cycle. Studies indicate that depletion of p300 down-regulates the acetylation and expression of p53, and chromatin immunoprecipitation (ChIP) analysis shows that induction of p21(Waf1/CIP1) in early differentiation is a result of p300 dependent activation of p53 and that depletion of p21(Waf1/CIP1) results in the delay of differentiation and a phenotype similar to p300 depletion. CONCLUSIONS: p300 has a direct role in the control of cell growth and differentiation in primary epithelial cells, and p21(Waf1/CIP1) is an important mediator of these p300 functions.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:1026/CDKN1A
Genes found in fulltext (GNAT)
EntrezGene:1017/CDK2
EntrezGene:1019/CDK4
EntrezGene:1026/CDKN1A
EntrezGene:1028/CDKN1C
EntrezGene:11883/Arsa
EntrezGene:12575/Cdkn1a
EntrezGene:22059/Trp53
EntrezGene:23432/GPR161
EntrezGene:5111/PCNA
EntrezGene:5925/RB1
EntrezGene:7157/TP53
EntrezGene:8626/TP63

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 1,2

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1, 2 chr17:7578416-7579378
0 chr6:36654830-36654849

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2805707.pdf CGTTAGTGCCAGGAAAGAC
1 PMC2805707.pdf CCAGGGCAGCTACGGTTTC
2 PMC2805707.pdf CTCCGTCATGTGCTGTGACTG
Display recognized sequences in FASTA format