text2genome

About us

Related Links

Press Coverage

PubMed: 1579500    PubMedCentral: PMC312315

Alternatively spliced p53 RNA in transformed and normal cells of different tissue types.

Han KA, Kulesz-Martin MF
Nucleic acids research, 1979 , 1992

Abstract:

The alternatively spliced RNA species of tumor suppressor gene p53, containing an additional 96 bases derived from intron 10, is present at approximately 25 to 30% the level of regularly spliced p53 RNA in both normal epidermal and carcinoma cells. The presence of this alternatively spliced RNA in 10T1/2 fibroblast cells, mouse liver and testis suggests that this alternative splicing may be universal. The level of alternatively spliced p53 RNA was increased coordinately with that of regularly spliced p53 in 10T1/2 cells in response to epidermal growth factor. Immunoprecipitation analysis of epidermal cells using monoclonal antibodies which recognize different epitopes of p53 suggested that distinct p53 proteins may be translated from both RNA species. Considering previous observations on the potential importance of carboxyl terminal sequences in p53 function, knowledge of the ubiquitous presence of alternatively spliced p53 is important for future studies of p53 function in normal cells and in oncogenesis.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:22059/Trp53
Genes found in fulltext (GNAT)
EntrezGene:13645/Egf
EntrezGene:22059/Trp53

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Trp53 ENSMUSG00000059552 0,1

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr11:69404214-69405299

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC312315.txt AGTCGAATTCAAGGATGCCCATGCTACAGA
1 PMC312315.txt AGTCGGATCCAGGGTGGGGGGTGGATAAA
Display recognized sequences in FASTA format