text2genome

About us

Related Links

Press Coverage

PubMed: 1486864    PubMedCentral: PMC1519610

Relationship of H-ras-1, L-myc, and p53 polymorphisms with lung cancer risk and prognosis.

Weston A, Caporaso NE, Perrin LS, Sugimura H, Tamai S, Krontiris TG, Trump BF, Hoover RN, Harris CC
Environmental health perspectives, 61 , 1992

Abstract:

Proto-oncogenes (H-ras-1 and L-myc) and tumor-suppressor gene (p53) loci have been implicated in lung carcinogenesis. DNA restriction fragment length polymorphisms at these gene loci are being evaluated in a case-control study as markers predictive of risk for cancer or of prognosis when cancer is present. The cases and controls had a cigarette-smoking history of 40 or more pack years or other abnormalities in pulmonary function tests, their ages were closely matched (64 years for cases and 61 years for controls) and the ratio of Caucasians to African Americans was close to unity (cases, 0.95:1.00, controls, 1.00:0.88). The H-ras-1 gene contains an insertion deletion polymorphism. Inheritance of rare H-ras-1 alleles, defined by MspI digestion, confers a relative risk for lung cancer of 2.0 (95% confidence interval, 0.5-7.3) for Caucasians and 3.2 (0.9-11.6) for African Americans (74 cases, 67 controls). The L-myc gene sequence has a restriction site (EcoR1) polymorphism between the second and third exons. Inheritance of restriction site-present alleles was reported to confer poor prognosis (presence of lymph node metastases) in Japanese lung cancer patients. This hypothesis was tested in both case-control study subjects (56 cases, 55 controls) and additional surgical cases (40), but no evidence was found to support the hypothesis in the U.S. population. The p53 gene is a tumor-suppressor gene that can encode either a proline or an arginine in the 72nd residue. No associations was found between the minor allele (proline) and diagnosis of lung cancer (76 cases, 68 controls).(ABSTRACT TRUNCATED AT 250 WORDS)

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:2487/FRZB
EntrezGene:27152/INTU
EntrezGene:4610/MYCL1
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 3,4

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr1:40364662-40364929
3 chr17:7579385-7579409

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1519610.txt AGTTCACTCACAGGCCACAT
1 PMC1519610.txt TGCATATCAGGAAGCTTGAG
2 PMC1519610.txt CCCCAACCCCAGCCCCCTAGCAGAGACCTGTGGGACGCG
3 PMC1519610.txt TGTCATCTTCTGTCCCTTCCCAGA
4 PMC1519610.txt ACACCGGCGGCCCCTGCACCA
Display recognized sequences in FASTA format