text2genome

About us

Related Links

Press Coverage

PubMed: 19229322    PubMedCentral: PMC2637987

A rapid crosstalk of human gammadelta T cells and monocytes drives the acute inflammation in bacterial infections.

Eberl M, Roberts GW, Meuter S, Williams JD, Topley N, Moser B
PLoS pathogens, , 2009

Abstract:

Vgamma9/Vdelta2 T cells are a minor subset of T cells in human blood and differ from other T cells by their immediate responsiveness to microbes. We previously demonstrated that the primary target for Vgamma9/Vdelta2 T cells is (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), an essential metabolite produced by a large range of pathogens. Here we wished to study the consequence of this unique responsiveness in microbial infection. The majority of peripheral Vgamma9/Vdelta2 T cells shares migration properties with circulating monocytes, which explains the presence of these two distinct blood cell types in the inflammatory infiltrate at sites of infection and suggests that they synergize in anti-microbial immune responses. Our present findings demonstrate a rapid and HMB-PP-dependent crosstalk between Vgamma9/Vdelta2 T cells and autologous monocytes that results in the immediate production of inflammatory mediators including the cytokines interleukin (IL)-6, interferon (IFN)-gamma, tumor necrosis factor (TNF)-alpha, and oncostatin M (OSM); the chemokines CCL2, CXCL8, and CXCL10; and TNF-related apoptosis-inducing ligand (TRAIL). Moreover, under these co-culture conditions monocytes differentiate within 18 hours into inflammatory dendritic cells (DCs) with antigen-presenting functions. Addition of further microbial stimuli (lipopolysaccharide, peptidoglycan) induces CCR7 and enables these inflammatory DCs to trigger the generation of CD4(+) effector alphabeta T cells expressing IFN-gamma and/or IL-17. Importantly, our in vitro model replicates the responsiveness to microbes of effluent cells from peritoneal dialysis (PD) patients and translates directly to episodes of acute PD-associated bacterial peritonitis, where Vgamma9/Vdelta2 T cell numbers and soluble inflammatory mediators are elevated in patients infected with HMB-PP-producing pathogens. Collectively, these findings suggest a direct link between invading pathogens, microbe-responsive gammadelta T cells, and monocytes in the inflammatory infiltrate, which plays a crucial role in the early response and the generation of microbe-specific immunity.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:117029/CCR5_RAT
EntrezGene:1234/CCR5
EntrezGene:1236/CCR7
EntrezGene:1435/CSF1
EntrezGene:1437/CSF2
EntrezGene:171369/NP_599187.1
EntrezGene:19090/Prkdc
EntrezGene:24932/CD4_RAT
EntrezGene:283297/OR10A4
EntrezGene:29187/NP_599154.1
EntrezGene:30835/CD209
EntrezGene:3439/IFNA1
EntrezGene:3565/IL4
EntrezGene:3569/IL6
EntrezGene:3576/IL8
EntrezGene:3586/IL10
EntrezGene:3596/IL13
EntrezGene:3627/CXCL10
EntrezGene:3684/ITGAM
EntrezGene:3688/ITGB1
EntrezGene:4149/MAX
EntrezGene:4360/MRC1
EntrezGene:5008/OSM
EntrezGene:50489/CD207
EntrezGene:51561/IL23A
EntrezGene:56822/NP_064466.1
EntrezGene:5710/PSMD4
EntrezGene:5711/PSMD5
EntrezGene:60350/CD14_RAT
EntrezGene:60628/CXCR4_RAT
EntrezGene:6347/CCL2
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7133/TNFRSF1B
EntrezGene:7852/CXCR4
EntrezGene:929/CD14
EntrezGene:942/CD86
EntrezGene:958/CD40
EntrezGene:959/CD40LG
EntrezGene:969/CD69

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
PPIA ENSG00000196262 1,2,0
CD86 ENSG00000114013 7,8
HLA-DRA ENSG00000226260 9,10,11
HLA-DRA ENSG00000230726 9,10,11
HLA-DRA ENSG00000234794 9,10,11
HLA-DRA ENSG00000206308 10,11,9
CCR7 ENSG00000126353 12,14
TNF ENSG00000204490 15,16
TNF ENSG00000206439 15,16
TNF ENSG00000223952 15,16
TNF ENSG00000228321 15,16
TNF ENSG00000228849 15,16
TNF ENSG00000230108 15,16
TNF ENSG00000232810 15,16
IL12A ENSG00000168811 17,18
IL12B ENSG00000113302 19,20
IL23A ENSG00000110944 21,22,23

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
15, 16 HSCHR6_MHC_APD:31555867-31556219
21, 22, 23 chr12:56733546-56733614
9, 10 HSCHR6_MHC_MCF:32485793-32486371
9, 10 HSCHR6_MHC_MANN:32449080-32449658
6 chr20:44757524-44757545
15, 16 chr6:31544546-31544898
0, 1, 2 chr21:20230377-20230467
4 chr7:5567988-5568017
9, 10 HSCHR6_MHC_COX:32358666-32359244
0, 1, 2 chr10:32477374-32477464
17, 18 chr3:159708019-159708063
0, 1, 2 chr5:81305541-81305631
19, 20 chr5:158743764-158743809
12, 13, 14 chr17:38711318-38711381

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2637987.S4.pdf TCCTGGCATCTTGTCCATG
1 PMC2637987.S4.pdf CCATCCAACCACTCAGTCTTG
2 PMC2637987.S4.pdf CAAATGCTGGACCCAACACAAATGG
3 PMC2637987.S4.pdf AGATGGCCACGGCTGCTAACCGCTCATTGCCAATGG
4 PMC2637987.S4.pdf AGCTCCTCCCTGGAGAAGAGCTACGAGCT
5 PMC2637987.S4.pdf AAGAAGCCAACCAATAAGGCCCGTCGGGAAAATTGATCTCC
6 PMC2637987.S4.pdf CCCACCCCAAGCAGGAACCCC
7 PMC2637987.S4.pdf GCGGCCTCGCAACTCTTATATCTCTTTTCTTGGTCTGTTCACTCTC
8 PMC2637987.S4.pdf ATGTGGAACCAACACAATGGAGAGGGA
9 PMC2637987.S4.pdf GCCAACCTGGAAATCATGACA
10 PMC2637987.S4.pdf AGGGCTGTTCGTGAGCACA
11 PMC2637987.S4.pdf CAACTATACTCCGATCACCAATGTACCTCCAGAG
12 PMC2637987.S4.pdf GCTCCAGGCACGCAACTTT
13 PMC2637987.S4.pdf ACCACGACCACAGCGATGA
14 PMC2637987.S4.pdf AGCGCAACAAGGCCATCAAGGTG
15 PMC2637987.S4.pdf GGTTTGCTACAACATGGGCTACA
16 PMC2637987.S4.pdf CATCTTCTCGAACCCCGAGTGACAAGC
17 PMC2637987.S4.pdf CCACTCCAGACCCAGGAATG
18 PMC2637987.S4.pdf TCCCATGCCTTCACCACTCCCAA
19 PMC2637987.S4.pdf ACGGACAAGACCTCAGCCAC
20 PMC2637987.S4.pdf TCATCTGCCGCAAAAATGCCAGC
21 PMC2637987.S4.pdf GAGCCTTCTCTGCTCCCTGAT
22 PMC2637987.S4.pdf AGTTGGCTGAGGCCCAGTAG
23 PMC2637987.S4.pdf CCTGTGGGCCAGCTTCATGCCT
Display recognized sequences in FASTA format