text2genome

About us

Related Links

Press Coverage

PubMed: 17222352    PubMedCentral: PMC1839129

Sequential gene profiling of basal cell carcinomas treated with imiquimod in a placebo-controlled study defines the requirements for tissue rejection.

Panelli MC, Stashower ME, Slade HB, Smith K, Norwood C, Abati A, Fetsch P, Filie A, Walters SA, Astry C, Aricó E, Zhao Y, Selleri S, Wang E, Marincola FM
Genome biology, R8 , 2007

Abstract:

BACKGROUND: Imiquimod is a Toll-like receptor-7 agonist capable of inducing complete clearance of basal cell carcinoma (BCC) and other cutaneous malignancies. We hypothesized that the characterization of the early transcriptional events induced by imiquimod may provide insights about immunological events preceding acute tissue and/or tumor rejection. RESULTS: We report a paired analysis of adjacent punch biopsies obtained pre- and post-treatment from 36 patients with BCC subjected to local application of imiquimod (n = 22) or vehicle cream (n = 14) in a blinded, randomized protocol. Four treatments were assessed (q12 applications for 2 or 4 days, or q24 hours for 4 or 8 days). RNA was amplified and hybridized to 17.5 K cDNA arrays. All treatment schedules similarly affected the transcriptional profile of BCC; however, the q12 x 4 days regimen, associated with highest effectiveness, induced the most changes, with 637 genes unequivocally stimulated by imiquimod. A minority of transcripts (98 genes) confirmed previous reports of interferon-alpha involvement. The remaining 539 genes portrayed additional immunological functions predominantly involving the activation of cellular innate and adaptive immune-effector mechanisms. Importantly, these effector signatures recapitulate previous observations of tissue rejection in the context of cancer immunotherapy, acute allograft rejection and autoimmunity. CONCLUSION: This study, based on a powerful and reproducible model of cancer eradication by innate immune mechanisms, provides the first insights in humans into the early transcriptional events associated with immune rejection. This model is likely representative of constant immunological pathways through which innate and adaptive immune responses combine to induce tissue destruction.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1236/CCR7
EntrezGene:1847/DUSP
EntrezGene:2833/CXCR3
EntrezGene:3106/HLA-B
EntrezGene:3558/IL2
EntrezGene:3627/CXCL10
EntrezGene:3660/IRF2
EntrezGene:3717/JAK2
EntrezGene:3718/JAK3
EntrezGene:4283/CXCL9
EntrezGene:4284/MIP
EntrezGene:4684/NCAM1
EntrezGene:596/BCL2
EntrezGene:6347/CCL2
EntrezGene:6348/CCL3
EntrezGene:6351/CCL4
EntrezGene:6773/STAT2
EntrezGene:712/C1QA
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:843/CASP10
EntrezGene:8743/TNFSF10
EntrezGene:9111/NMI
EntrezGene:9235/IL32
EntrezGene:951/CD37
EntrezGene:968/CD68

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000204490 0,1
TNF ENSG00000206439 0,1
TNF ENSG00000223952 0,1
TNF ENSG00000228321 0,1
TNF ENSG00000228849 0,1
TNF ENSG00000232810 0,1
TNF ENSG00000230108 1,0
IFNA13 ENSG00000233816 2,3,4
IFNG ENSG00000111537 5,6,7
CCL2 ENSG00000108691 8,9,10
PPIG ENSG00000138398 11,12,13

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 HSCHR6_MHC_DBB:31527361-31527406
0, 1 HSCHR6_MHC_APD:31556538-31556583
8, 9, 10 chr17:32584013-32584119
5, 6, 7 chr12:68549174-68549250
0, 1 HSCHR6_MHC_QBL:31535460-31535505
0, 1 HSCHR6_MHC_COX:31532629-31532674
0, 1 chr6:31545217-31545262
0, 1 HSCHR6_MHC_MANN:31584704-31584749
11, 13 chr2:170493351-170493406
0, 1 HSCHR6_MHC_SSTO:31535160-31535205
0, 1 HSCHR6_MHC_MCF:31621526-31621571
2, 3, 4 chr9:21305040-21385158

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1839129.S2.doc GGAGAAGGGTGACCGACTCA
1 PMC1839129.S2.doc CGCTGAGATCAATCGGCCCGACTA
2 PMC1839129.S2.doc TTCCTCCTGTCTGATGGACAGA
3 PMC1839129.S2.doc TGGAACTGGTTGCCATCAAA
4 PMC1839129.S2.doc TGACTTTGGATTTCCCCAGGAG
5 PMC1839129.S2.doc CCAACGCAAAGCAATACATGA
6 PMC1839129.S2.doc TTTTCGCTTCCCTGTTTTAGCT
7 PMC1839129.S2.doc TCATCCAAGTGATGGCTGAACTGTCGC
8 PMC1839129.S2.doc CATGGTACTAGTGTTTTTTAGATACAGAGACTT
9 PMC1839129.S2.doc TAATGATTCTTGCAAAGACCCTCAA
10 PMC1839129.S2.doc AACCACAGTTCTACCCCTGGGATG
11 PMC1839129.S2.doc TGAGCATGATCACAGTAAAAGTAAGGA
12 PMC1839129.S2.doc TTGTTCTGCTATTATAACTGTGTTTACCTTTAG
13 PMC1839129.S2.doc AAGGATAGACGCGCACAATCCAGGAGT
Display recognized sequences in FASTA format