text2genome

About us

Related Links

Press Coverage

PubMed: 17877801    PubMedCentral: PMC2034565

Common TNF-alpha, IL-1 beta, PAI-1, uPA, CD14 and TLR4 polymorphisms are not associated with disease severity or outcome from Gram negative sepsis.

Jessen KM, Lindboe SB, Petersen AL, Eugen-Olsen J, Benfield T
BMC infectious diseases, 108 , 2007

Abstract:

BACKGROUND: Several studies have investigated single nucleotide polymorphisms (SNPs) in candidate genes associated with sepsis and septic shock with conflicting results. Only few studies have combined the analysis of multiple SNPs in the same population. METHODS: Clinical data and DNA from consecutive adult patients with culture proven Gram negative bacteremia admitted to a Danish hospital between 2000 and 2002. Analysis for commonly described SNPs of tumor necrosis-alpha, (TNF-alpha), interleukin-1 beta (IL-1 beta), plasminogen activator-1 (PAI-1), urokinase plasminogen activator (uPA), CD14 and toll-like receptor 4 (TLR4) was done. RESULTS: Of 319 adults, 74% had sepsis, 19% had severe sepsis and 7% were in septic shock. No correlation between severity or outcome of sepsis was observed for the analyzed SNPs of TNF-alpha, IL-1 beta, PAI-1, uPA, CD14 or TLR-4. In multivariate Cox proportional hazard regression analysis, increasing age, polymicrobial infection and haemoglobin levels were associated with in-hospital mortality. CONCLUSION: We did not find any association between TNF-alpha, IL-1 beta, PAI-1, uPA, CD14 and TLR4 polymorphisms and outcome of Gram negative sepsis. Other host factors appear to be more important than the genotypes studied here in determining the severity and outcome of Gram negative sepsis.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:929/CD14
EntrezGene:3553/IL1B
EntrezGene:5054/SERPINE1
EntrezGene:5328/PLAU
EntrezGene:7099/TLR4
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
Genes found in fulltext (GNAT)
EntrezGene:3929/LBP
EntrezGene:5054/SERPINE1
EntrezGene:5327/PLAT
EntrezGene:5328/PLAU
EntrezGene:7099/TLR4
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:929/CD14

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000206439 0,3
TNF ENSG00000223952 0,3
TNF ENSG00000228321 0,3
TNF ENSG00000228849 0,3
TNF ENSG00000230108 0,3
TNF ENSG00000232810 0,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1, 3 HSCHR6_MHC_SSTO:31532955-31533139
0, 1, 3 HSCHR6_MHC_COX:31530424-31530723
0, 1, 3 chr6:31543012-31543196
6 chr5:140012832-140012925
0, 1, 3 HSCHR6_MHC_DBB:31525156-31525340
0, 1, 3 HSCHR6_MHC_MANN:31582499-31582683
0, 1, 3 HSCHR6_MHC_MCF:31619321-31619505
0, 1, 3 HSCHR6_MHC_QBL:31533253-31533437

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2034565.pdf TAGGTTTTGAGGGGCATGGGGAC
1 PMC2034565.pdf TCTCGGTTTCTTCTCCATCG
2 PMC2034565.pdf TAGGTTTTGAGGGGCATGGGGAC
3 PMC2034565.pdf GGGTTCAGCCTCCAGGGTCCTACACAC
4 PMC2034565.pdf CACTCCCAGCTTCATCCCTAG
5 PMC2034565.pdf GTCTGGACACGTGGGGAtACTGCAGGAACCCAGACAACtAGTCCATCGTTTGGTTCTGGAGGTGCATCGTGCACATAAGTGCAGCCAGCCACGTGATTGTCTAGAGGGAGGCAGGTAGGAGAAAAATAGTCACACTCACCAGGGAAA
6 PMC2034565.pdf tCACCCACCAGAGAAGGCTTAATCACCTCCCCACCTCTCTTGCCTAAAGCCGCTTGTCCAAGGCCTAAAGCTGCTTGTCCAAAGTCAATAATATCATCGAGGTAGAGTCAATAATACCATCGAGGTAGGGAGGGGGGCCGTAACAGGGAGGGGGACCGTAACAG
Display recognized sequences in FASTA format