text2genome

About us

Related Links

Press Coverage

PubMed: 18159231    PubMedCentral: PMC2131784

Inhibition of Chk1 kills tetraploid tumor cells through a p53-dependent pathway.

Vitale I, Galluzzi L, Vivet S, Nanty L, Dessen P, Senovilla L, Olaussen KA, Lazar V, Prudhomme M, Golsteyn RM, Castedo M, Kroemer G
PloS one, , 2007

Abstract:

Tetraploidy constitutes an adaptation to stress and an intermediate step between euploidy and aneuploidy in oncogenesis. Tetraploid cells are particularly resistant against genotoxic stress including radiotherapy and chemotherapy. Here, we designed a strategy to preferentially kill tetraploid tumor cells. Depletion of checkpoint kinase-1 (Chk1) by siRNAs, transfection with dominant-negative Chk1 mutants or pharmacological Chk1 inhibition killed tetraploid colon cancer cells yet had minor effects on their diploid counterparts. Chk1 inhibition abolished the spindle assembly checkpoint and caused premature and abnormal mitoses that led to p53 activation and cell death at a higher frequency in tetraploid than in diploid cells. Similarly, abolition of the spindle checkpoint by knockdown of Bub1, BubR1 or Mad2 induced p53-dependent apoptosis of tetraploid cells. Chk1 inhibition reversed the cisplatin resistance of tetraploid cells in vitro and in vivo, in xenografted human cancers. Chk1 inhibition activated p53-regulated transcripts including Puma/BBC3 in tetraploid but not in diploid tumor cells. Altogether, our results demonstrate that, in tetraploid tumor cells, the inhibition of Chk1 sequentially triggers aberrant mitosis, p53 activation and Puma/BBC3-dependent mitochondrial apoptosis.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:1111/CHEK1
EntrezGene:7157/TP53
Genes found in fulltext (GNAT)
EntrezGene:1111/CHEK1
EntrezGene:11200/CHEK2
EntrezGene:12367/Casp3
EntrezGene:22059/Trp53
EntrezGene:2597/GAPDH
EntrezGene:26524/LATS2
EntrezGene:27113/BBC3
EntrezGene:4085/MAD2L1
EntrezGene:467/ATF3
EntrezGene:57120/GOPC
EntrezGene:578/BAK1
EntrezGene:581/BAX
EntrezGene:596/BCL2
EntrezGene:598/BCL2L1
EntrezGene:6303/SAT1
EntrezGene:699/BUB1
EntrezGene:701/BUB1B
EntrezGene:7157/TP53
EntrezGene:8349/HIST2H2BE
EntrezGene:9140/ATG12
EntrezGene:9212/AURKB

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
ATF3 ENSG00000162772 0,1
BAD ENSG00000002330 4,5
CHEK1 ENSG00000149554 12,13
TP53 ENSG00000141510 17,18
BBC3 ENSG00000105327 21,20
SAT1 ENSG00000130066 22,23
BIRC5 ENSG00000089685 24,25
VIL2 ENSG00000092820 27,28

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
6 chr19:49464080-49464099
9 chr22:18222219-18222240
12, 13 chr11:125497564-125503128
22, 23 chrX:23801925-23803464
0, 1 chr1:212791497-212791565
27, 28 chr6:159197510-159206485
10 chr2:111431684-111431705
21 chr19:47729839-47729858
24, 25 chr17:76210488-76210787
18 chr17:7574004-7574023

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2131784.S2.doc GAGGCGACGAGAAAGAAATTT
1 PMC2131784.S2.doc GAAGAAGGAGAAGACGGAGTT
2 PMC2131784.S2.doc AtgCAGAGGAACCTGCTGGCGATT
3 PMC2131784.S2.doc GGAGGAGGATCTACTTGATTT
4 PMC2131784.S2.doc AAGAAGGGACTTCCTCGCCCGTT
5 PMC2131784.S2.doc CTGGGCAGCCATCTTGAATTT
6 PMC2131784.S2.doc GGTGCCGGAACTGATCAGATT
7 PMC2131784.S2.doc GCTGCACCTGACGCCCTTCTT
8 PMC2131784.S2.doc CAGGGACAGCATATCAGAGTT
9 PMC2131784.S2.doc GAAGACATCATCCGGAATATT
10 PMC2131784.S2.doc ATACCACAATGACCCAAGATT
11 PMC2131784.S2.doc AAGGGAAGCCGAGCTGTTGAC
12 PMC2131784.S2.doc GCGTGCCGTAGACTGTCCATT
13 PMC2131784.S2.doc TCGTGAGCGTTTGTTGAACTT
14 PMC2131784.S2.doc TGTGTGAATGACAACTACTTT
15 PMC2131784.S2.doc ATTGCACTGTCACTAAGCATT
16 PMC2131784.S2.doc ACCTTTACTCGAGTGCAGATT
17 PMC2131784.S2.doc GACTCCAGTGGTAATCTACTT
18 PMC2131784.S2.doc GTGAGCGCTTCGAGATGTTTTGt
19 PMC2131784.S2.doc GAACGAGGAGACGGTAATATT
20 PMC2131784.S2.doc TCTCATCATGGGACTCCTGTT
21 PMC2131784.S2.doc TTGAGGTCGTCCGCCATCCTT
22 PMC2131784.S2.doc GGTGCTCTCCAAAACCATCTT
23 PMC2131784.S2.doc GGACACAGCATTGTTGGTTTT
24 PMC2131784.S2.doc GCGCCTGCACCCCGGAGCGTT
25 PMC2131784.S2.doc GGCTGGCTTCATCCACTGCTT
26 PMC2131784.S2.doc GTACGGCCTGACGTTTACATT
27 PMC2131784.S2.doc AAGGAATCCTTAGCGATGAGATT
28 PMC2131784.S2.doc CCCCAAAGATTGGCTTTCCTT
Display recognized sequences in FASTA format