text2genome

About us

Related Links

Press Coverage

PubMed: 19895686    PubMedCentral: PMC2779195

A Smac-mimetic sensitizes prostate cancer cells to TRAIL-induced apoptosis via modulating both IAPs and NF-kappaB.

Dai Y, Liu M, Tang W, Li Y, Lian J, Lawrence TS, Xu L
BMC cancer, 392 , 2009

Abstract:

BACKGROUND: Although tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a promising agent for human cancer therapy, prostate cancer still remains resistant to TRAIL. Both X-linked inhibitor of apoptosis (XIAP) and nuclear factor-kappaB function as key negative regulators of TRAIL signaling. In this study, we evaluated the effect of SH122, a small molecule mimetic of the second mitochondria-derived activator of caspases (Smac), on TRAIL-induced apoptosis in prostate cancer cells. METHODS: The potential of Smac-mimetics to bind XIAP or cIAP-1 was examined by pull-down assay. Cytotoxicity of TRAIL and/or Smac-mimetics was determined by a standard cell growth assay. Silencing of XIAP or cIAP-1 was achieved by transient transfection of short hairpin RNA. Apoptosis was detected by Annexin V-PI staining followed by flow cytometry and by Western Blot analysis of caspases, PARP and Bid. NF-kappaB activation was determined by subcellular fractionation, real time RT-PCR and reporter assay. RESULTS: SH122, but not its inactive analog, binds to XIAP and cIAP-1. SH122 significantly sensitized prostate cancer cells to TRAIL-mediated cell death. Moreover, SH122 enhanced TRAIL-induced apoptosis via both the death receptor and the mitochondrial pathway. Knockdown of both XIAP and cIAP-1 sensitized cellular response to TRAIL. XIAP-knockdown attenuated sensitivity of SH122 to TRAIL-induced cytotoxicity, confirming that XIAP is an important target for IAP-inhibitor-mediated TRAIL sensitization. SH122 also suppressed TRAIL-induced NF-kappaB activation by preventing cytosolic IkappaB-alpha degradation and RelA nuclear translocation, as well as by suppressing NF-kappaB target gene expression. CONCLUSION: These results demonstrate that SH122 sensitizes human prostate cancer cells to TRAIL-induced apoptosis by mimicking Smac and blocking both IAPs and NF-kappaB. Modulating IAPs may represent a promising approach to overcoming TRAIL-resistance in human prostate cancer with constitutively active NF-kappaB signaling.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:23114/NFASC
EntrezGene:329/BIRC2
EntrezGene:331/XIAP
EntrezGene:3383/ICAM1
EntrezGene:3576/IL8
EntrezGene:3815/KIT
EntrezGene:4790/NFKB1
EntrezGene:54107/POLE3
EntrezGene:56616/DIABLO
EntrezGene:5970/RELA
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:8626/TP63
EntrezGene:8743/TNFSF10
EntrezGene:8795/TNFRSF10B
EntrezGene:9131/AIFM1

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000204490 0,1
TNF ENSG00000206439 0,1
TNF ENSG00000223952 0,1
TNF ENSG00000228321 0,1
TNF ENSG00000228849 0,1
TNF ENSG00000230108 0,1
TNF ENSG00000232810 0,1
ACTB ENSG00000075624 3,4
XIAP ENSG00000101966 5,6

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0 HSCHR6_MHC_MCF:31620623-31620646
3, 4 chr7:5567367-5567682
0 HSCHR6_MHC_APD:31555635-31555658
0 HSCHR6_MHC_QBL:31534557-31534580
5, 6 chrX:123019623-123019698
0 HSCHR6_MHC_COX:31531726-31531749
0 chr6:31544314-31544337
0 HSCHR6_MHC_MANN:31583801-31583824
0 HSCHR6_MHC_SSTO:31534257-31534280
0 HSCHR6_MHC_DBB:31526458-31526481
2 chr4:74607263-74607286

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2779195.pdf CCAGGGACCTCTCTCTAATCAGC
1 PMC2779195.pdf CTCAGCTTGAGGGTTTGCTACAA
2 PMC2779195.pdf TCTTTAGCACTCCTTGGCAAAAC
3 PMC2779195.pdf ATGCAGAAGGAGATCACTGC
4 PMC2779195.pdf TCATAGTCCGCCTAGAAGCA
5 PMC2779195.pdf AGTGGTAGTCCTGTTTCAGCATCA
6 PMC2779195.pdf CCGCACGGTATCTCCTTCA
Display recognized sequences in FASTA format