text2genome

About us

Related Links

Press Coverage

PubMed: 12204102    PubMedCentral: PMC150507

Activation of adherent vascular neutrophils in the lung during acute endotoxemia.

Sunil VR, Connor AJ, Zhou P, Gordon MK, Laskin JD, Laskin DL
Respiratory research, 21 , 2002

Abstract:

BACKGROUND: Neutrophils constitute the first line of defense against invading microorganisms. Whereas these cells readily undergo apoptosis under homeostatic conditions, their survival is prolonged during inflammatory reactions and they become biochemically and functionally activated. In the present study, we analyzed the effects of acute endotoxemia on the response of a unique subpopulation of neutrophils tightly adhered to the lung vasculature. METHODS: Rats were treated with 5 mg/kg lipopolysaccharide (i.v.) to induce acute endotoxemia. Adherent neutrophils were isolated from the lung vasculature by collagenase digestion and sequential filtering. Agarose gel electrophoresis, RT-PCR, western blotting and electrophoretic mobility shift assays were used to evaluate neutrophil activity. RESULTS: Adherent vascular neutrophils isolated from endotoxemic animals exhibited decreased apoptosis when compared to cells from control animals. This was associated with a marked increase in expression of the anti-apoptotic protein, Mcl-1. Cells isolated 0.5-2 hours after endotoxin administration were more chemotactic than cells from control animals and expressed increased tumor necrosis factor-alpha and cyclooxygenase-2 mRNA and protein, demonstrating that they are functionally activated. Endotoxin treatment of the animals also induced p38 and p44/42 mitogen activated protein kinases in the adherent lung neutrophils, as well as nuclear binding activity of the transcription factors, NF-kappaB and cAMP response element binding protein. CONCLUSION: These data demonstrate that adherent vascular lung neutrophils are highly responsive to endotoxin and that pathways regulating apoptosis and cellular activation are upregulated in these cells.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:12043/Bcl2
EntrezGene:12048/Bcl2l1
EntrezGene:1385/CREB1
EntrezGene:207/AKT1
EntrezGene:21926/Tnf
EntrezGene:24224/BCL2_RAT
EntrezGene:24835/TNFA_RAT
EntrezGene:24887/BAX_RAT
EntrezGene:24888/B2CL1_RAT
EntrezGene:24888/NP_001028843.1
EntrezGene:29527/PGH2_RAT
EntrezGene:308/ANXA5
EntrezGene:4170/MCL1
EntrezGene:50689/MK03_RAT
EntrezGene:581/BAX
EntrezGene:596/BCL2
EntrezGene:598/BCL2L1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:81646/CREB1_RAT

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 2,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0 chr1:151949821-151949843
2, 3 chr17:35337416-35338643

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC150507.pdf CATTCTTTGCCCAGCACTTCAC
1 PMC150507.pdf GACCAGGCACCAAGACCAAAGAC
2 PMC150507.pdf TCTGTCTACTGAACTTCGGGGT
3 PMC150507.pdf TAGTTGGTTGTCTTTGAGATCC
4 PMC150507.pdf AGAGATTGCCTGACGTCAGAGAGCTAG
5 PMC150507.pdf AGTTGAGGGGACTTTCCCAGGC
6 PMC150507.pdf TGCAGATTGCGCAATCTGCA
Display recognized sequences in FASTA format