text2genome

About us

Related Links

Press Coverage

PubMed: 17397264    PubMedCentral: PMC1839167

Bacterial ligands generated in a phagosome are targets of the cytosolic innate immune system.

Herskovits AA, Auerbuch V, Portnoy DA
PLoS pathogens, , 2007

Abstract:

Macrophages are permissive hosts to intracellular pathogens, but upon activation become microbiocidal effectors of innate and cell-mediated immunity. How the fate of internalized microorganisms is monitored by macrophages, and how that information is integrated to stimulate specific immune responses is not understood. Activation of macrophages with interferon (IFN)-gamma leads to rapid killing and degradation of Listeria monocytogenes in a phagosome, thus preventing escape of bacteria to the cytosol. Here, we show that activated macrophages induce a specific gene expression program to L. monocytogenes degraded in the phago-lysosome. In addition to activation of Toll-like receptor (TLR) signaling pathways, degraded bacteria also activated a TLR-independent transcriptional response that was similar to the response induced by cytosolic L. monocytogenes. More specifically, degraded bacteria induced a TLR-independent IFN-beta response that was previously shown to be specific to cytosolic bacteria and not to intact bacteria localized to the phagosome. This response required the generation of bacterial ligands in the phago-lysosome and was largely dependent on nucleotide-binding oligomerization domain 2 (NOD2), a cytosolic receptor known to respond to bacterial peptidoglycan fragments. The NOD2-dependent response to degraded bacteria required the phagosomal membrane potential and the activity of lysosomal proteases. The NOD2-dependent IFN-beta production resulted from synergism with other cytosolic microbial sensors. This study supports the hypothesis that in activated macrophages, cytosolic innate immune receptors are activated by bacterial ligands generated in the phagosome and transported to the cytosol.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:15977/Ifnb1
EntrezGene:257632/Nod2
Species found in fulltext (Linnaeus)
Listeria monocytogenes
Mus musculus
Mus sp.
Helicobacter pylori
Homo sapiens
Propionibacterium acnes
Mycobacterium tuberculosis
Genes found in fulltext (GNAT)
EntrezGene:142980/Tlr3
EntrezGene:257632/Nod2

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Ifnb1 ENSMUSG00000048806 0,1
Tnf ENSMUSG00000024401 4,5
Il6 ENSMUSG00000025746 6,7
Il12b ENSMUSG00000004296 8,9

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
6, 7 chr5:30339920-30339971
0, 1 chr4:88168504-88168555
8, 9 chr11:44217555-44221339
3 chr5:143667105-143667125
2 chr6:83476909-83476928
4, 5 chr17:35336825-35336876

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1839167.pdf ctggagcagctgaatggaaag
1 PMC1839167.pdf cttgaagtccgccctgtaggt
2 PMC1839167.pdf aggtgtgatggtgggaatgg
3 PMC1839167.pdf gcctcgtcacccacatagga
4 PMC1839167.pdf gcaccaccatcaaggactcaa
5 PMC1839167.pdf tcgaggctccagtgaattcg
6 PMC1839167.pdf ttccatccagttgccttcttg
7 PMC1839167.pdf gaaggccgtggttgtcacc
8 PMC1839167.pdf aaccatctcctggtttgcca
9 PMC1839167.pdf cgggagtccagtccacctc
Display recognized sequences in FASTA format