text2genome

About us

Related Links

Press Coverage

PubMed: 16322811    PubMedCentral: PMC1297496

Modulation of radiation-induced disturbances of antioxidant defense systems by ginsan.

Han Y, Son SJ, Akhalaia M, Platonov A, Son HJ, Lee KH, Yun YS, Song JY
Evidence-based complementary and alternative medicine : eCAM, 529 , 2005

Abstract:

There are numerous studies to indicate that irradiation induces reactive oxygen species (ROS), which play an important causative role in radiation damage of the cell. We evaluated the effects of ginsan, a polysaccharide fraction extracted from Panax ginseng, on the gamma-radiation induced alterations of some antioxidant systems in the spleen of Balb/c mice. On the 5th day after sublethal whole-body irradiation, homogenized spleen tissues of the irradiated mice expressed only marginally increased mRNA levels of Mn-SOD (superoxide dimutase) in contrast to Cu/Zn-SOD, however, catalase mRNA was decreased by approximately 50% of the control. In vivo treatment of non-irradiated mice with ginsan (100 mg kg(-1), intraperitoneal administration) had no significant effect, except for glutathione peroxidase (GPx) mRNA, which increased to 144% from the control. However, the combination of irradiation with ginsan effectively increased the SODs and GPx transcription as well as their protein expressions and enzyme activities. In addition, the expression of heme oxygenase-1 and non-protein thiol induced by irradiation was normalized by the treatment of ginsan. Evidence indicated that transforming growth factor-beta and other important cytokines such as IL-1, TNF and IFN-gamma might be involved in evoking the antioxidant enzymes. Therefore, we propose that the modulation of antioxidant enzymes by ginsan was partly responsible for protecting the animal from radiation, and could be applied as a therapeutic remedy for various ROS-related diseases.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Panax ginseng
Mus sp.
Bos taurus
Mus musculus
Avian myeloblastosis virus
Simian virus 40
Homo sapiens
Rattus norvegicus
Lateolabrax japonicus
Trametes versicolor
Genes found in fulltext (GNAT)
EntrezGene:12359/Cat
EntrezGene:12981/Csf2
EntrezGene:14775/Gpx1
EntrezGene:20655/Sod1
EntrezGene:21926/Tnf
EntrezGene:3162/HMOX1
EntrezGene:3439/IFNA1
EntrezGene:4092/SMAD7
EntrezGene:6098/ROS1
EntrezGene:7018/TF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:847/CAT

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Ifng ENSMUSG00000055170 2,3
Il1b ENSMUSG00000027398 4,5
Tnf ENSMUSG00000024401 6,7
Cat ENSMUSG00000027187 12,13
Tgfb1 ENSMUSG00000002603 17,18
Actb ENSMUSG00000029580 19,20

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0 chr3:68495980-68496000
19, 20 chr5:143665450-143665924
17 chr7:26481962-26481987
12 chr2:103303506-103303526
11 chr6:67155847-67155867
6, 7 chr17:35337435-35338763
14 chr9:108242139-108242159
2, 3 chr10:117878270-117882314
5 chr2:129192992-129193019

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1297496.pdf ACCTCAGTTTGGCCAGGGTC
1 PMC1297496.pdf GTCACGACGCGGGTGGTGAAG
2 PMC1297496.pdf TACTGCCACGGCACAGTCATTGAA
3 PMC1297496.pdf GCAGCGACTCCTTTTCCGCTTCCT
4 PMC1297496.pdf TGAAGGGCTGCTTCCAAACCTTTGACC
5 PMC1297496.pdf TGTCCATTGAGGTGGAGAGCTTTCAGC
6 PMC1297496.pdf GCGACGTGGAACTGGCAGAAG
7 PMC1297496.pdf TCCATGCCGTTGGCCAGGAGG
8 PMC1297496.pdf GCACATTAACGCGCAGATCA
9 PMC1297496.pdf AGCCTCCAGCAACTCTCCTT
10 PMC1297496.pdf AAGGCCGTGTGCGTGCTGAA
11 PMC1297496.pdf CAGGTCTCCAACATGCCTCT
12 PMC1297496.pdf GCAGATACCTGTGAACTGTC
13 PMC1297496.pdf GTAGAATGTCCGCACCTGAG
14 PMC1297496.pdf CCTCAAGTACGTCCGACCTG
15 PMC1297496.pdf GTAGAATGTCCGCACCTGAG
16 PMC1297496.pdf TGTCATCTCCAGAGTGTTC
17 PMC1297496.pdf GCTCACTGCTCTTGTGACAGCAAAG
18 PMC1297496.pdf CAAGGACCTTGCTGTACTGTGTGTC
19 PMC1297496.pdf TGGAATCCTGTGGCATCCATGAAAC
20 PMC1297496.pdf TAAAACGCAGCTCAGTAACAGTCCG
Display recognized sequences in FASTA format