text2genome

About us

Related Links

Press Coverage

PubMed: 17416347    PubMedCentral: PMC2096715

Effects of apoE genotype on macrophage inflammation and heme oxygenase-1 expression.

Jofre-Monseny L, Loboda A, Wagner AE, Huebbe P, Boesch-Saadatmandi C, Jozkowicz A, Minihane AM, Dulak J, Rimbach G
Biochemical and biophysical research communications, 319 , 2007

Abstract:

In order to gain a more comprehensive understanding of the aetiology of apolipoprotein E4 genotype-cardiovascular disease (CVD) associations, the impact of the apoE genotype on the macrophage inflammatory response was examined. The murine monocyte-macrophage cell line (RAW 264.7) stably transfected to produce equal amounts of human apoE3 or apoE4 was used. Following LPS stimulation, apoE4-macrophages showed higher and lower concentrations of tumour necrosis factor alpha (pro-inflammatory) and interleukin 10 (anti-inflammatory), respectively, both at mRNA and protein levels. In addition, increased expression of heme oxygenase-1 (a stress-induced anti-inflammatory protein) was observed in the apoE4-cells. Furthermore, in apoE4-macrophages, an enhanced transactivation of the key redox sensitive transcription factor NF-kappaB was shown. Current data indicate that apoE4 macrophages have an altered inflammatory response, which may contribute to the higher CVD risk observed in apoE4 carriers.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:11816/Apoe
EntrezGene:15368/Hmox1

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 2,3
Il1b ENSMUSG00000027398 4,5
Il6 ENSMUSG00000025746 6,7
Ccl3 ENSMUSG00000000982 8,9
Il10 ENSMUSG00000016529 10,11

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
13 chr10:80643824-80643845
6, 7 chr5:30339744-30339979
8, 9 chr11:83462117-83462801
10, 11 chr1:132917914-132919112
2, 3 chr17:35337378-35337847
0, 1 chr5:143665532-143665799

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2096715.pdf GACAGGATGCAGAAGGAGATTACT
1 PMC2096715.pdf TGATCCACATCTGCTGGAAGGT
2 PMC2096715.pdf CATCTTCTCAAAATTCGAGTGACAA
3 PMC2096715.pdf TGGGAGTAGACAAGGTACAACCC
4 PMC2096715.pdf CAACCAACAAGTGATATTCTCCATG
5 PMC2096715.pdf GATCCACACTCTCCAGCTGCA
6 PMC2096715.pdf CTGCAAGAGACTTCCATCCAGTT
7 PMC2096715.pdf GAAGTAGGGAAGGCCGTGG
8 PMC2096715.pdf CCTCTGTCACCTGCTCAACA
9 PMC2096715.pdf GATGAATTGGCGTGGAATCT
10 PMC2096715.pdf GGTTGCCAAGCCTTATCGGA
11 PMC2096715.pdf ACCTGCTCCACTGCCTTGCT
12 PMC2096715.pdf GCGGTCAGCACAATGGCATA
13 PMC2096715.pdf GACATCACCAAGGGTGTGCAG
14 PMC2096715.pdf GTGGAGACGCTTTACGTAGTGC
15 PMC2096715.pdf GACATCACCAAGGGTGTGCAG
Display recognized sequences in FASTA format